DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_069718
Line Availability available from NASC (N569718) and ABRC (SALK_069718)
Confirmed for Hit At4g14950
Parent of DUPLO pair 54
Parent of pair(s) none

Gene hit At4g14950

 
Sequence (A. th genome BLAST matches underlined) 
TTGGTTATTACAAACGCAGATGATAAATATCGTCTACATTACGAAAAAGGAGAAACAAGC
ACATAAGAAACAAAGTTAAAAAACCATTTGGGTGTTAAACTAGTATCTATGAGACACGAG
GTTCTGAACCTGTATATGAGTTTTGATGATCGCCTTTCCGATTAAGGTCGCCAGGAAGAA
TT
GenBank Accession BH849454 [GenBank]
Graphic View Graphic view of gene At4g14950
Predicted Position of Insertion Chr4:8547279 - go to primer design
BLAST e Value 3e-99
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SNARE associated Golgi protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH849454 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37