DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_111817c
Line Availability available from NASC (N686653) and ABRC (SALK_111817c)
Parent of DUPLO pair 2814
Parent of pair(s) none

Gene hit At5g65600

 
Sequence (A. th genome BLAST matches underlined)
CTTCTTGGAGTGCGCGCTCTCGCNGCCGNGATTTTTGTCTTGCNNNGATCTCTTATGATT
CCGTGACCCCGAATTTAAGTGTGACTTGGGCTTATGAGCTAACAGCAACCTCTGATCCTA
AGGAGAGTTCAAGCCTTTCTTACATCATCGACCTCGCTAAGGTTCTGCCATCAGATGTTA
TGTTCGGGTTTATAGCTGCCGCTGGGGACAACACAGAAGAACATAGACTTTTATCATGGG
AGCTCAGTTTCAGTTTGGACAGCGACAAAGCCGATAGCAGGATAAGACTAGTAATTGGCA
TTT
GenBank Accession BZ763047 [GenBank]
Graphic View Graphic view of gene At5g65600
Predicted Position of Insertion Chr5:26217591 - go to primer design
BLAST e Value 1e-124
Hit Clone Code (BAC ID) K21L13
Hit Gene Code At5g65600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on Thursday, 10 June 2021 13:37