DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_115549c
Line Availability available from NASC (N656886) and ABRC (SALK_115549c)
Confirmed for Hit At2g43460
Parent of DUPLO pair 946
Parent of pair(s) none

Gene hit At2g43460

 
Sequence (A. th genome BLAST matches underlined) 
AATCATAAGCATCCATGACGGCGATATGAAACGAAATCGAAAGACCGAGAAATATTGTAC
CATTCTCGAATCTGTTGGTTGAAACTAGCCGCCGTCCACAGAGAGAGTCGAGCGAATT
GenBank Accession BZ380709 [GenBank]
Graphic View Graphic view of gene At2g43460
Predicted Position of Insertion Chr2:18047230 - go to primer design
BLAST e Value 3e-61
Hit Clone Code (BAC ID) T1O24
Hit Gene Code At2g43460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal L38e protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37