DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_117769
Line Availability available from NASC (N617769) and ABRC (SALK_117769)
Confirmed for Hit At4g27890
Parent of DUPLO pair 6854
Parent of pair(s) none

Gene hit At4g27890

 
Sequence (A. th genome BLAST matches underlined) 
TCATCATGATCAAGATAAAGAAACCGATATAACTTACCATCATCTTCTCAACGGATGCGC
GAGTTTCAGGGTCGAGATCACCAAGTTTGCTGGTCTCTGGTTCAACTTTCTGAGTGTCTA
TCTCAGGTTCTCCCTTCACACAATACTTCCACCACTCCATCTGGTCTTGCTTTGTCAAGA
GCACCGATATCATCTTTTGATCCTCGATATTCCAGAAGCAGTCGTCAGGCTTGACAGAAT
TGA
GenBank Accession BZ382037 [GenBank]
Graphic View Graphic view of gene At4g27890
Predicted Position of Insertion Chr4:13887020 - go to primer design
BLAST e Value 1e-135
Hit Clone Code (BAC ID) T27E11
Hit Gene Code At4g27890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation HSP20-like chaperones superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37