Sequences from confirmation amplicon


Confirmation sequences for line 012H09 and hit At5g52260 are shown.
Line ID 012H09
Locus At5g52260 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:21219976
Primers used for PCR M19a - 8474, show primer details
   
Sequence Name 14-K014432-0022-012-H09C-M19a
GenBank Accession LN492276 [GenBank]
Sequencing primer gene specific primer, M19a: 5'-ATTTTGCAATCCGAGACCAC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K014432-0022-012-H09C-M19a
TAATCAGACCCAAATCATAAAAATCAAATGAAAAATCTACTTAATGAATGGTTTTTCACA
TAGACCTGAATGGATTGTAGACAACAAAAATAGAAGGTGTATTTTTTATTAGGGTTTCTT
ACTTGTTACCCAAGGAAGAATGTAAAGTCAAGATGGTCTCTTCTTCTTCTTCACTAAACG
ACCCCCTCTTTATTCCTGGTCTTAGGTAATTAATCCACCTTAATCTGCAGCTTTTCCCAT
TCCTTTGCAATCCTGGCACAACAATTACTCTTAGTTAAGGATAAGATTAACAACAATGAT
GAGAATTAAGAGTCTAATATAGGATATAGGGTTAAGAAAAAAAGAGAGTCTAATATAAGA
TTTTAGAGATTAAAAAAAAACCAGCTAGGATGGGAACAGTGGTCCAGCAAGCATGGCCAC
GAGAGAGGATGAAACTCTTGAGCTTCTGGTCTTCTTCAGGTGACCATAACCCTTTCCTCT
GTCTCTGTTTTGGTCTCTCTCCAGATTTGGTCATCTTCCACGTATCTTTCTTTCTCTCTC
AAGTCGTCTTAATTAAGAGAAACTTGTGTAAATGATGAATTAGAGAGATAGAGAGAGGGA
CAAAGACAGACAGAGAGAAGTATTATGAGCATATATAGATAATTATGCATAGATAGAGTC
ATAGAGAAACCATTATATTAAACGCAAACACAAAAATTACGTTCATAGAAATTATTCAGG
ATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCACCCATGAGTAT
GATG
   
Sequence Name 13-K014432-0022-012-H09C-8409
GenBank Accession LN491814 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K014432-0022-012-H09C-8409
TCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAATAATTTCT
ATGAACGTAATTTTTGTGTTTGCGTTTAATATAATGGTTTCTCTATGACTCTATCTATGC
ATAATTATCTATATATGCTCATAATACTTCTCTCTGTCTGTCTTTGTCCCTCTCTCTATC
TCTCTAATTCATCATTTACACAAGTTTCTCTTAATTAAGACGACTTGAGAGAGAAAGAAA
GATACGTGGAAGATGACCAAATCTGGAGAGAGACCAAAACAGAGACAGAGGAAAGGGTTA
TGGTCACCTGAAGAAGACCAGAAGCTCAAGAGTTTCATCCTCTCTCGTGGCCATGCTTGC
TGGACCACTGTTCCCATCCTAGCTGGTTTTTTTTTAATCTCTAAAATCTTATATTAGACT
CTCTTTTTTTCTTAACCCTATATCCTATATTAGACTCTTAATTCTCATCATTGTTGTTAA
TCTTATCCTTAACTAAGAGTAATTGTTGTGCCAGGATTGCAAAGGAATGGGAAAAGCTGC
AGATTAAGGTGGATTAATTACCTAAGACCAGGACTAAAGAGGGGGTCGTTTAGTGAAGAA
AAAGAAGAGACCATCTTGACTTTACATTCTTCCTTGGGTAACAAGTAAGAAACCCTAATA
AAAAATACACCTTCTATTTTTGTTGTCTACAATCCATTCAGGTCTATGTGAAAAACCATT
CATTAAGTAGATTTTTCATTTGATTTTTATG

Last Updated on 23.10.2014 13:25