SimpleSearch - Line and FST details


Line specific information

 
Line ID 012H09
Vector Used pAC106
Line Availability only available from NASC (N401149)
Segregation Analysis 100:96:90
Confirmed for Hit At5g52260
Parent of DUPLO pair 2498
Parent of pair(s) none

Gene hit At5g52260

 
Sequence (A. th genome BLAST matches underlined)
>10-K120096-0022-012-H09C-8409
TTGAATATATCCTGAATAATTTCTATGAACGTAATTTTTGTGTTTGCGTTTAATATAATG
GTTTCTCTATGACTCTATCTATGCATAATTATCTATATATGCTCATAATACTTCTCTCTG
TCTGTCTTTGTCCCTCTCTCTATCTCTCTAATTCATCATTTACACAAGTTTCTCTTAATT
AAGACGACTTGAGAGAGAAAGAAAGATACGTGGAAGATGACCAAATCTGGAGAGAGACCA
AAACAGAGACAGAGGAAAGGGTTATGGTCACCTGAAGAAGACCAGAAGCTCAAGAGTTTC
ATCCTCTCTCGTGGCCATGCTTGCTGGACCACTGTTCCCATCCTAGCTGGTTTTTTTTTA
ATCTCTAAAATCTTATATTAGACTCTCTTTTTTTCTTAACCCTATATCCTATATTAGACT
CTTAATTCTCATCATTGTTGTTAATCTTATCCTTAACTAAGAGTAATTGTTGTGCCAGGA
TTGCAAAGGAATGGGAAAAGCTGCAGATTAAGGTGGATTAATTACCTAAGACCAGGACTA
AAGAGGGGGTCGTTTAGTGAAGAAGAAGAAGAGACCATCTTGACGTTTCATTCTTCCTGG
GGGTAACA
GenBank Accession LN713376 [GenBank]
Graphic View Graphic view of gene At5g52260
Predicted Position of Insertion Chr5:21219976 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F17P19
Hit Gene Code At5g52260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 19
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL752440 [GenBank] AL752441 [GenBank]


Last Updated on 07.07.2016 14:03