Sequences from confirmation amplicon


Confirmation sequences for line 013F12 and hit At4g04750 are shown.
Line ID 013F12
Locus At4g04750 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:2421162
Primers used for PCR RK23 - 8474, show primer details
   
Sequence Name 55-K025676-022-013-F12C-8409
GenBank Accession LN508685 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>55-K025676-022-013-F12C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATATTTACAATTGACCCTCTACCGGTAAA
TAATAACCCCATTCTTCTTCTTTGATATTTCTTCATCAAACGGTCAATCATTATCTGATT
GAATGATCAGGTGTATCAAGTGACATTGGATTCATATTGACATCTATTGTTCAGGTTTTA
CTAATATAAGATCATAAAGCATGACTATTATTCATAAGTTTATTTTTCCTATAACAATCT
ATCATCATTCTTGTAGATGACTGGAGGCGTTTTAGGTGTTTTGCTTGTGGATATATCCGG
AAGACGTTCTCTCCTACTGGTAAACGAAATTTAAAACTCGAAAAACCGAAAGTGTATAAA
TAATCGAATCGATAAGTTATTTGAAATTATTTGTTTTGAAGAAGATTAAAGAGAAGATTT
TTTGAGTGATTGTAGTTTTCTCAAGCTGGAATGTTCTTGGGTTGTCTAGCAACAGCCATT
TCATTCTTCTTGCA
   
Sequence Name 56-K025676-022-013-F12C-RK23
GenBank Accession LN508985 [GenBank]
Sequencing primer gene specific primer, RK23: 5'-AGTAAACATGCCTGCAAGAAGAAT-3'
Sequence (A. th genome BLAST matches underlined)
>56-K025676-022-013-F12C-rk23
ATGGCTGTTGCTAGACAACCCAAGAACATTCCAGCTTGAGAAAACTACAATCACTCAAAA
AATCTTCTCTTTAATCTTCTTCAAAACAAATAATTTCAAATAACTTATCGATTCGATTAT
TTATACACTTTCGGTTTTTCGAGTTTTAAATTTCGTTTACCAGTAGGAGAGAACGTCTTC
CGGATATATCCACAAGCAAAACACCTAAAACGCCTCCAGTCATCTACAAGAATGATGATA
GATTGTTATAGGAAAAATAAACTTATGAATAATAGTCATGCTTTATGATCTTATATTAGT
AAAACCTGAACAATAGATGTCAATATGAATCCAATGTCACTTGATACACCTGATCATTCA
ATCAGATAATGATTGACCGTTTGATGAAGAAATATCAAAGAAGAAGAATGGGGTTATTAT
TTACCGGTAGAGGGTCAATTGTAAATATTCAATTGTAAATGGCTTCATGTCCGGGAAATC
TACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAA
TTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTT
TGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATT
CTAATTCGGAAATCTTTATNTCGACGTGTCTA
Primers used for PCR FM71 - 3144, show primer details
   
Sequence Name 20-K029206-022-013-F12C-FM71
GenBank Accession LN495082 [GenBank]
Sequencing primer gene specific primer, FM71: 5'-ACACGATTAAAAACAACCAGATCC-3'
Sequence (A. th genome BLAST matches underlined)
>20-K029206-022-013-F12C-FM71
CTCTCCAACCCATAAAATACGATTAAAGTTACCAAAGGCTAGCTTATCAATGATTTGATC
ATTGATGAATTTTGTTTGTAGGCTAAAGTTGGGAGGGAAAAGGAGGTTGAAGGGGTTTTA
TTAAGCTTGCGAGGAGCAAAATCTGATGTATCAGATGAAGCAGCAACGATATTAGTAAGG
ATATATAAATATACATGCATTATAATAGTCATATGATCAACATATATATTTACATTGATT
TCCCAAATTTTTGATGATCATCAGGAATATACAAAACATGTCGAACAACAAGACATCGAT
AGCCGCGGTTTCTTCAAGTTGTTCCAGCGAAAATACGCGTTGCCACTAACTGTAAGTAAC
TTTTCAAAAAGAGGTAACAACATAAAATTGAAAACATTATTATCTTTGCATTTTCTTAAT
TATTCAACCCTTTTGTTTTACACAGATTGGAGTTGTCCTTATATCTATGCCTCAGCTTGG
AGGTCTTAATGGTTATACTTTTTACACAAACACTGATAGTTTAAACCGAAGGCGGGAAAC
GACAATCTGATCCCCGGGTACCCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAG
GAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCA
CATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTC
GTGGGTG

Last Updated on 23.10.2014 13:25