SimpleSearch - Line and FST details


Line specific information

 
Line ID 013F12
Vector Used pAC106
Line Availability only available from NASC (N401224)
Segregation Analysis 50:38:28
Confirmed for Hit At4g04750
Parent of DUPLO pair none
Parent of pair(s) 9575, 96395, 96440, 96471, 96478, 96501, 96502

Gene hit T19F6

 
Sequence (A. th genome BLAST matches underlined)
>94-K025780-022-019-F12-8409
CTGATAGTTTAAACCGAAGGCGGGAAACGACAATCTGATCCCCGAGTATGGGATCCTCCC
TATAGTGAGANNTNNNNCTNNTTTNTGANNGNNNACCTCNNTATCGCCCTCTACCCTCTC
CCCCTCTCCCCGCCCGTTGGCCGATTCATTAATGCACCTGGCACGACAGGTTTCCCGACT
GGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCC
AGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAAT
TTCTCACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACT
CTAGAGGATCCCCGGGTACGGGATCCTCCATTTTGAGGGGTGGCCATACTTTTTTTTTTT
TGGACCAATAGTACTTAAGAGGCATTTTTTTTATTAAAGGTTTGTATATCGCTCTTTTTG
TTATTTCTTTTTCT
GenBank Accession FR800307 [GenBank]
Graphic View Graphic view of sequence FR800307 of line 013F12
Predicted Position of Insertion Chr4:12510257 - go to primer design
BLAST e Value 5e-05
Hit Clone Code (BAC ID) T19F6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g04750

 
Sequence (A. th genome BLAST matches underlined)
>94-K024345-022-013-F12t-8409
TACTACCCTCAGTTCTTCTTCTTTGACATTCCCACATCACACGGTCACGCATTATCTGAT
TGAATGATCACGTGTATCAAGTGACATCTGGATTCCTATTGACCTCTATTGTTCCAGTGT
TACTATCATAAGAGCATCTGGCATGACTATTATTCATAATTTTATTTTTCCTATAACAAT
CTATCATCATTCGTTGTATAATGACGCTAGTCATTTACCCTGTTTTGTATAAGAGAAGCT
TCAAAACTCTAATAAGTCTT
GenBank Accession BX890706 [GenBank]
Graphic View Graphic view of gene At4g04750
Predicted Position of Insertion Chr4:2421163 - go to primer design
BLAST e Value 6e-45
Hit Clone Code (BAC ID) T4B21
Hit Gene Code At4g04750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968567 [GenBank] BX890707 [GenBank] BX890706 [GenBank]


Last Updated on 31.08.2016 09:40