Sequences from confirmation amplicon


Confirmation sequences for line 026A07 and hit At2g46450 are shown.
Line ID 026A07
Locus At2g46450 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:19066885
Primers used for PCR UK05 - 8474, show primer details
   
Sequence Name 18-K019547-022-026-A07C-UK05
GenBank Accession LN494116 [GenBank]
Sequencing primer gene specific primer, UK05: 5'-TACATGCGTAATTATAGGTGGTGG-3'
Sequence (A. th genome BLAST matches underlined)
>18-K019547-022-026-A07C-UK05
CACTCTCATACCACTGTCTGCGTCGCTGGTGTCAGAGAGAATACTGAAATGGATTATACT
TAGTCAATATGTACCAAGAATCATTCGTATGTATCCGCTTTATAAAGAAGTGACAAGAGC
CTTTGGTACGGTAGCAGAATCAAAGTGGGCTGGAGCTGCTTTAAACTTATTCCTTTACAT
GCTGCACAGTTATGTAAGTCTTTGCTCTTGATCCCACTTCCCACCCACTGTTGTTGTTGT
TGATGGATGGCTACTATGTATATAGGTGTTTGGGGCTTTTTGGTACTTGAGTTCAATAGA
AAGGAAAAGCAAATGTTGGCGTGCCGCGTGTGCTAGGACATCCGACTGCAATCTCACGGT
CACGGATCTGCTTTGTAAACGAGCTGGCAGTGACAACATTCGATTCCTCAACACTTCATG
CCCATTAATCGACCCTGCCCAAATCACGTCCGGGAATTTTTTATCAATTGTAAATGGCTT
CATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGA
AAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAA
AATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGC
AATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT
   
Sequence Name 19-K019547-022-026-A07C-8409
GenBank Accession LN494564 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K019547-022-026-A07C-8409
CTAGATTTCCCGGACATGAAGCCATTTACAATTGATAAAAAATTCCCGGACGTGATTTGG
GCAGGGTCGATTAATGGGCATGAAGTGTTGAGGAATCGAATGTTGTCACTGCCAGCTCGT
TTACAAAGCAGATCCGTGACCGTGAGATTGCAGTCGGATGTCCTAGCACACGCGGCACGC
CAACATTTGCTTTTCCTTTCTATTGAACTCAAGTACCAAAAAGCCCCAAACACCTATATA
CATAGTAGCCATCCATCAACAACAACAACAGTGGGTGGGAAGTGGGATCAAGAGCAAAGA
CTTACATAACTGTGCAGCATGTAAAGGAATAAGTTTAAAGCAGCTCCAGCCCACTTTGAT
TCTGCTACCGTACCAAAGGCTCTTGTCACTTCTTTATAAAGCGGATACATACGAATGATT
CTTGGTACATATTGACTAAGTATAATCCATTTCAGTATTCTCTCTGACACCAGCGACGCA
GACAGTGGTATGAGAGTGAGAACCACCACCTA

Last Updated on 07.07.2016 14:16