SimpleSearch - Line and FST details


Line specific information

 
Line ID 026A07
Vector Used pAC106
Line Availability only available from NASC (N402407)
Segregation Analysis 100:95:88
Confirmed for Hit At2g46450
Parent of DUPLO pair none
Parent of pair(s) 6306, 6319, 81594, 81600

Gene hit At2g46450

 
Sequence (A. th genome BLAST matches underlined)
>49-K013759-022-026-A07-8409
AGATTTCCTGCACTGAAGCACTTTACAATTGATAAAAAATTCCCGGACGTGATTTGGGCA
GGGTCGATTAATGGGCATGAAGTGTTGAGGAATCGAATGTTGTCACTGCCAGCTCGTTTA
CAAAGCAGATCCGTGACCGTGAGATTGCAGTCGGATGTCCTATGGGATCCTCCCTATAGT
GATGAGNAAAAAAATTTTNTTTTTTTTTCCTTAAAAGTTTATCCCAAAACCTTATGGAAT
CCTCCT
GenBank Accession AL762566 [GenBank]
Graphic View Graphic view of gene At2g46450
Predicted Position of Insertion Chr2:19066889 - go to primer design
BLAST e Value 8e-58
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cyclic nucleotide-gated channel 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23