Sequences from confirmation amplicon


Confirmation sequences for line 027B04 and hit At5g49770 are shown.
Line ID 027B04
Locus At5g49770 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:20222766
Primers used for PCR DW02 - 8474, show primer details
   
Sequence Name 57-K021645-022-027-B04C-8409
GenBank Accession LN509281 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>57-K021645-022-027-B04C-8409
CATGTTCTTTGCTAACAAGCATGTAAGACATAAAGGAGAAGACTTTGAACAAGTTAAGCG
AAAATTTATAAATAAAGCAAACAAATAGACAGTGGACCATATAAACAAATAGTTCAACTT
GATATAGATAATAAAGAACCGCTATATATTGCGGAAGGGTTCAAAGGTATTATCCAAGGG
AGAAATTGAAATGTCAATACGGTAATGTGGAGGAACAAATTATGAACAATGACTTGGCAC
AAAACACCATTATAATAGACTAGTCCTTTATTAACTACATAAATAAATCTGTTTACATGA
TAAAGCATAAATATGCAATATGTAACAAAACTTAACTAAATGATCTAACATTTAATTGTT
TCTGCACAAAACTGGGAGAAGTCATGTATATATTATTTGTTTTCCTAGAACGTTTCTTCT
CAAGAAAAGAGAGATTTTTGAAATAGAGTAATGGTAAGCGACTATGCACTGATATGGTTT
TTCTAACAGCAACATGCAAAAAAAGT
   
Sequence Name 58-K021645-022-027-B04C-DW02
GenBank Accession LN509579 [GenBank]
Sequencing primer gene specific primer, DW02: 5'-ATGACTTTATTGCATGTTGCTGTT-3'
Sequence (A. th genome BLAST matches underlined)
>58-K021645-022-027-B04C-DW02
TCGCTTACCATTACTCTATTTCAAAAATCTCTCTTTTCTTGAGAAGAAACGTTCTAGGAA
AACAAATAATATATACATGACTTCTCCCAGTTTTGTGCAGAAACAATTAAATGTTAGATC
ATTTAGTTAAGTTTTGTTACATATTGCATATTTATGCTTTATCATGTAAACAGATTTATT
TATGTAGTTAATAAAGGACTAGTCTATTATAATGGTGTTTTGTGCCAAGTCATTGTTCAT
AATTTGTTCCTCCACATTACCGTATTGACATTTCAATTTCTCCCTTGGATAATACCTTTG
AACCCTTCCGCAATATATAGCGGTTCTTTATTATCTATATCAAGTTGAACTATTTGTTTA
TATGGTCCACTGTCTATTTGTTTGCTTTATTTATAAATTTTCGCTTAACTTGTTCAAAGT
CTTCTCCTTTATGTCTTACATGCTTTGTTAGCAAAGAACATGGCTTCATGTCCGGGAAAT
CTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCA
ATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATT
TTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTAT
TCTAATTCGGAAATCTTTATTTCGACGTGTCTA

Last Updated on 07.07.2016 14:16