SimpleSearch - Line and FST details


Line specific information

 
Line ID 027B04
Vector Used pAC106
Line Availability only available from NASC (N402512)
Segregation Analysis 100:62:58
Confirmed for Hit At5g49770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g49770

 
Sequence (A. th genome BLAST matches underlined)
>26-K013728-022-027-B04-8409
NAATGGGATCCATGTAGATTTCCCTTGACATGAAGCACTGTTCTTTGCTAACAAAGCATG
TAAGACATATAGGAGAAGACTTTGAACAAGTTAAGCGAAAATTTATAAATAAAGCAAACA
AATAGACAGTGGACCATATAAACAAATAGTTCAACTTGATATAGATAATAAAGAACCGCT
ATATATTGCGGAAGGGTTCAAAGGTATTATCCAAGGGAGAAATTGAAATGTCAATACGGT
AATGTGGAGGAACAAATTATGAACAATGACTTGGCACAAAACACCATTATAATAGGCTAT
GGGATCCTCCC
GenBank Accession AL762684 [GenBank]
Graphic View Graphic view of gene At5g49770
Predicted Position of Insertion Chr5:20222764 - go to primer design
BLAST e Value 9e-141
Hit Clone Code (BAC ID) K2I5
Hit Gene Code At5g49770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40