Sequences from confirmation amplicon


Confirmation sequences for line 030A06 and hit At1g49540 are shown.
Line ID 030A06
Locus At1g49540 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:18337616
Primers used for PCR KU26 - 8474, show primer details
   
Sequence Name 01-K102173-0022-030-A06C-8409
GenBank Accession LN486517 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K102173-0022-030-A06C-8409
CTTTACATTGAATATATCCTGAAACCTAAGTCAATTGGATGATTTGGGCCCAATTGGACC
TAATTCGGCCCATTTAATATTCCCTCTTTTCTAACCTTTGTTTCTCCTCTTGCTTGCTCA
CCCTTTTCCCTGAATCTTAAGAATTACTAATTCCCGGCGAGTTTTCCCGGCGGCGGCTAG
ATAATACTGGTTTCTGCCAGCAAGATCGAAGGAGATAAACTTCGTAATCAAAAAGTCTCC
TTCTGATAAAAAGATGTCAGAAAACACAAAAGTCGAAGCGAAGAGAGTGTTCATAGGAGC
AGGATGCAACAGAGTCGTCAATAACGTCTCTTGGGGAGCTTCTGGTCTTGTCTCTTTCGG
TGCCCAAAACGCCGTTGCTGTTTTCTGCCCTAAGGTCTGTTTGTTCCACTCTTGTCTCTC
TCTTTCAAAATCATTCCAAAAGCAAAGATGTGATTTTTTTTGGGTGTGTTTTGTGTCTTT
GTTTAATGTTTTTTTCAGACTGCCCAGATTCTTACAACGCTCCCAGGTCATAAAGCTTCT
GTGAATTGCACTCATTGGTTACCCACTTCCAAGTTTGCCTTCAAAGGTAGGACTTAAAGC
TTACTTGCTGTAATTTTGAATCCTTTGGTTTATAGGAACTTCTTTTGCTATCTATTTAGA
GAGTTTTAAGTATGTTGAATCGCTTAGGCATTGCTAAAGGATGAGACTTTTGATGTTTTA
TAAGATAGAGAACATAGGTTGAAGAATTTGTGAGTGATAGCAAATTGAGAAGATATAGGC
ATTCAAATTTTCTATTTATAGTCTCTATCTACGGTTTGGTGATTTAGTTGCTGTGAAAGG
TTTTATGTATTTGTATCTCCCTGAAT
   
Sequence Name 01-K102177-0022-030-A06C-KU26
GenBank Accession LN486518 [GenBank]
Sequencing primer gene specific primer, KU26: 5'-AACGATCATAGAAAATTCAGGGAG-3'
Sequence (A. th genome BLAST matches underlined)
>01-K102177-0022-030-A06C-KU26
TAACTTTCAGCACTAAATCACCAAACCGTAGATAGAGACTATAAATAGAAAATTTGAATG
CCTATATCTTCTCAATTTGCTATCACTCACAAATTCTTCAACCTATGTTCTCTATCTTAT
AAAACATCAAAAGTCTCATCCTTTAGCAATGCCTAAGCGATTCAACATACTTAAAACTCT
CTAAATAGATAGCAAAAGAAGTTCCTATAAACCAAAGGATTCAAAATTACAGCAAGTAAG
CTTTAAGTCCTACCTTTGAAGGCAAACTTGGAAGTGGGTAACCAATGAGTGCAATTCACA
GAAGCTTTATGACCTGGGAGCGTTGTAAGAATCTGGGCAGTCTGAAAAAAACATTAAACA
AAGACACAAAACACACCCAAAAAAAATCACATCTTTGCTTTTGGAATGATTTTGAAAGAG
AGAGACAAGAGTGGAACAAACAGACCTTAGGGCAGAAAACAGCAACGGCGTTTTGGGCAC
CGAAAGAGACAAGACCAGAAGCTCCCCAAGAGACGTTATTGACGACTCTGTTGCATCCTG
CTCCTATGAACACTCTCTTCGCTTCGACTTTTGTGTTTTCTGACATCTTTTTATCAGAAG
GAGACTTTTTGATTACGAAGTTTATCTCCTTCGATCTTGCTGGCAGAAACCAGTATTATC
TAGCCGCCGCCGGGAAAACTCGCCGGGAATTAGTAATTCTTAAGATTCAGGGAAAAGGGT
GAGCAAGCAAGAGGAGAAACAAAGGTTAGAAAAGAGGGAATATTAAATGGGCCGAATTAG
GTCCAATTGGGCCCAAATCATCCAATTGACTTAGGTTTCAGGATATATTCAATTGTAAAT
GGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTNCATATGGAGAA
AAAGAAAGAGTAATTACCAATTTTTTTTCAATCAAAATGTAGATGT

Last Updated on 23.10.2014 13:25