SimpleSearch - Line and FST details


Line specific information

 
Line ID 030A06
Vector Used pAC106
Line Availability only available from NASC (N402790)
Segregation Analysis 50:29:19
Confirmed for Hit At1g49540
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g49540

 
Sequence (A. th genome BLAST matches underlined)
>41-K025983-022-030-A06-8409
NNNTTTCGAGATATTCGGACATGAGCCTTTACAATTGAATATATCCTGTCAACACTGATA
GTTTAAACCGAAGGCGGGAAACGACAATCTGATCCCCGAGTATGGGATCCTCCCTATAGA
GAGATTCCATTGAGAACTGAGCCATGTGCACCTTCCCCCCAACACGGTGAGCGACGGGGC
AACGGAGTGATCCACATGGGACTTTTAAACATCATCCGTCGGATGGCGTTGCGAGAGAAG
CAGTCGATCCGTGAGATCAGCCGACGCACCGGGCAGGCGCGCAACACGATCGCAAAGTAT
TTGAACGCAAGTATGGGATCCTCCCTATAGTGAGAACTGACTCTTCAATAACGTCTCTTG
GGGAGCTTCTGGACTTGTCTCTTTCGGTGCCCAAAACGCCCTTGCTGTTTTCTGCCCTAA
GGTCTGTTTGTTCCACTCTTGTCTCTCTCTTTCAAAATCATTCCAAAAGCAAAGATGTGA
TTTTTTTTGGGTGTGTTTTGTGTCTTTGTTTAATGTTTTTTTCAGACTGCCCAGATTCTT
ACAACGCTCCCAGGTCATAAAGCTTCT
GenBank Accession CR395520 [GenBank]
Graphic View Graphic view of gene At1g49540
Predicted Position of Insertion Chr1:18337604 - go to primer design
BLAST e Value 2e-66
Hit Clone Code (BAC ID) F13F21
Hit Gene Code At1g49540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation elongator protein 2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR395519 [GenBank]


Last Updated on 07.07.2016 14:03