Sequences from confirmation amplicon


Confirmation sequences for line 031A02 and hit At5g07070 are shown.
Line ID 031A02
Locus At5g07070 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:2198089
Primers used for PCR JK01 - 8474, show primer details
   
Sequence Name 27-K020358-022-031-A02C-8409
GenBank Accession LN498185 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K020358-022-031-A02C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCCATTCTTAATA
CACTTGGTTTGTTCTCCATCCTTAAAATCTACAAACTTCAAACTACTACCTCAAAGCATT
TGAGTTTTTAAACCCAGTTTGTTGATTCCAAATCAAGTTAGGTTAACTACTACTGAATCA
AAAAAGCACAATAGGATCAGGACTCAGAAGTCTAACCTTTTAGACCAACAACACAAAACC
GATTTCGATATCTCCTGTAACAAAAAGATTGAGAAGCAAGACGAAGAGAAACCACTCGAA
AGAGAAAGGAAGAAGAAACAGTCACTTCTCTCTTGTATGATGAAACCGAATTGAGGGATG
AATCCGAAAGACAAAAGAGAACGAACGGATCTCTCTGTTTGGTTGACTAGTGGACTCAGT
TCTGCTCCTCTGTCTAAATTCTTTTTATTTATATTTTTGGATTTTATGTTTTAAAAAAGA
AATAAAGGAAAATCTAAGAGTTCCTTTTTAAATAGTTGCGTGGAAGTGAA
   
Sequence Name 31-K020358-022-031-A02C-JK01
GenBank Accession LN499970 [GenBank]
Sequencing primer gene specific primer, JK01: 5'-CTAATGTCTATTCACTTCCACGCA-3'
Sequence (A. th genome BLAST matches underlined)
>31-K020358-022-031-A02C-JK01
AAAGGAACTCTTAGATTTTCCTTTATTTCTTTTTTAAAACATAAAATCCAAAAATATAAA
TAAAAAGAATTTAGACAGAGGAGCAGAACTGAGTCCACTAGTCAACCAAACAGAGAGATC
CGTTCGTTCTCTTTTGTCTTTCGGATTCATCCCTCAATTCGGTTTCATCATACAAGAGAG
AAGTGACTGTTTCTTCTTCCTTTCTCTTTCGAGTGGTTTCTCTTCGTCTTGCTTCTCAAT
CTTTTTGTTACAGGAGATATCGAAATCGGTTTTGTGTTGTTGGTCTAAAAGGTTAGACTT
CTGAGTCCTGATCCTATTGTGCTTTTTTGATTCAGTAGTAGTTAACCTAACTTGATTTGG
AATCAACAAACTGGGTTTAAAAACTCAAATGCTTTGAGGTAGTAGTTTGAAGTTTGTAGA
TTTTAAGGATGGAGAACAAACCAAGTGTATTAAGAATGGCAGGATATATTCAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAAGGATTACCCATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
Primers used for PCR FL55 - 3144, show primer details
   
Sequence Name 42-K029744-022-031-A02C-FL55
GenBank Accession LN504341 [GenBank]
Sequencing primer gene specific primer, FL55: 5'-AGCAGGTGTACCACAAGTTGTATG-3'
Sequence (A. th genome BLAST matches underlined)
>42-K029744-022-031-A02C-FL55
CATCAGCAAGCGCACTTAAACCAAAATCAGATACCTTAAGATTATCATTGTCATCCAACA
AAAGATTTTCCGGCTTAATGTCGCGGTGATAAACTCCGCGGCTGTGACAAAAATCAACCG
CACTAATAAGCTGATAAAAATACTTCCAAGCAACATCTTCTTTAAGTTTTCCTTTTGCAA
CCTTGTTGAAAAGCTCACCACCTTTACAATACTCAATAACAAAGTAAATCCTTGACTTTG
TAGCCATAACCTCGTATAACTCAACGACATTCGGGTGTTTAGCGATCCTCATTACAGAGA
TCTCTCGCTTGATTTGCTGGCTAAGCCCGACTCTCATAACTTTGTCCTTGTCAATCATCT
TGATAGCTACACTCTCGTTGGTATGATTACTCCTTCCAAAATACACTTTAGCAAAAGTAC
CTTGTTATTGGGTCAATTGATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTAC
GATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTAT
TTCGACGTGTCTAC

Last Updated on 23.10.2014 13:25