SimpleSearch - Line and FST details


Line specific information

 
Line ID 031A02
Vector Used pAC106
Line Availability only available from NASC (N402882)
Segregation Analysis 100:70:56
Confirmed for Hit At5g07070
Parent of DUPLO pair none
Parent of pair(s) 5269, 5407, 10290, 89899, 89901, 89902, 89905, 89906, 89907, 89908, 89909, 89910, 89911, 89912, 89913, 89914, 89915, 89916, 89918, 89919

Gene hit At5g07070

 
Sequence (A. th genome BLAST matches underlined)
>09-K113048-0022-031-A02-8409
CTTTTATCCCAGATTGGTTGATTTCCTTTTCAAGTTCGGTTACCTACTTCTGCATCTTAG
AATTGCAATAGGATCGGGACTTAGACTTTCTTTTTTTTAGACCAGCCACTCAAACCCGAT
GTTGATATCTGCTGATTCCCAGGGATTGAGAACCATGACGAATAGAAACCACTCTGAAGA
TATAGGAAGAATAAACTGTCACTTCTCTCTTGTATGATGAAACCGAATTGAGGGATGAAT
CCGAAAGACAAGTTAGTAACGAACGGATCTCTCTGTTTGGTTGACTTACCTGCCCACGCC
TCTAGTTGTCNAAAGAGCACGATTTGAGTCCGACTGCTATTTCTTACCGTTTGCACCAAC
ACCGCCCTCTCTATTTCAATGGCTGTACTTTTGGATAGATTGAGAACTAAGACTACGACC
TACTTCTCGGCGAAGGCACGAAGACGAGACATTCACTTCTGTGTTGTTTGTTTAAACCTG
CTTGAGGGATGATTCCGACGGAGGCTTGAGATCAAACCGATCTCTCTGTATGGTTGACTA
TCCGCGNCAAAANNTTAAAATGNCCNNNCTGGNTTGCTCCTGNGGTGNGGNGGCTNTTGT
GTNNGATGTTGGACCCTATCCATGAGACTA
GenBank Accession FR800812 [GenBank]
Graphic View Graphic view of gene At5g07070
Predicted Position of Insertion Chr5:2198096 - go to primer design
BLAST e Value 1e-41
Hit Clone Code (BAC ID) MOJ9
Hit Gene Code At5g07070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CBL-interacting protein kinase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL762952 [GenBank] AL762952 [GenBank] FR800812 [GenBank]


Last Updated on 31.08.2016 09:40