Sequences from confirmation amplicon


Confirmation sequences for line 034H03 and hit At5g56740 are shown.
Line ID 034H03
Locus At5g56740 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:22955320
Primers used for PCR ER01 - 8474, show primer details
   
Sequence Name 17-K023019-022-034-H03C-8409
GenBank Accession LN493687 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K023019-022-034-H03C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAAAATTAGGGTTACGTTTCCTGCTTTCG
ACCTTTTTGGTGAAATTAGTTGGCCTTACTTCAATTTTTCTAGTTTTTGGCTTTTCCGGC
GAACTTTATTGCTTTCAAAAGGTAGTTTTCAGTTATTGAACATGTAGAGCAGATCTGTAT
ACTGAGTTTCTGTTGATTTATGTGTTTTATCTTTCTTCCAATTGATATTTGTTCAATGAG
TTGTAAAAGTATTTTCTGTGTGAAGTGTCTTAGGTTGCTGTGACATAATTTTGTTTTCTG
TTTTGGTAATCGTGATGGGTGATGTTCTAGTTTCAAGCAAAGAGGAAGTTGATTCCTCTG
ATATTTCCAGCGTGAAGCCAGTTGACTTGAATGATTTCTTTGATGGAGATGGCAAGATTT
ATGGTTACCA
   
Sequence Name 18-K023019-022-034-H03C-ER01
GenBank Accession LN494134 [GenBank]
Sequencing primer gene specific primer, ER01: 5'-ACCTTCAAACCTTGGTAACCATAA-3'
Sequence (A. th genome BLAST matches underlined)
>18-K023019-022-034-H03C-ER01
GCCATCTCCATCAAAGAAATCATTCAAGTCAACTGGCTTCACGCTGGAAATATCAGAGGA
ATCAACTTCCTCTTTGCTTGAAACTAGAACATCACCCATCACGATTACCAAAACAGAAAA
CAAAATTATGTCACAGCAACCTAAGACACTTCACACAGAAAATACTTTTACAACTCATTG
AACAAATATCAATTGGAAGAAAGATAAAACACATAAATCAACAGAAACTCAGTATACAGA
TCTGCTCTACATGTTCAATAACTGAAAACTACCTTTTGAAAGCAATAAAGTTCGCCGGAA
AAGCCAAAAACTAGAAAAATTGAAGTAAGGCCAACTAATTTCACCAAAAAGGTCGAAAGC
AGGAAACGTAACCCTAATTTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTT
CAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAA
CGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCG
GAAAATCTTTATTTCGACGTGTCTACA
Primers used for PCR FL67 - 8474, show primer details
   
Sequence Name 53-K029745-022-034-H03C-8409
GenBank Accession LN508044 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K029745-022-034-H03C-8409
CTTTCATTGAATATATCCTGTCAACTTCAAATGATTTAAATCAAATACGCACCGAGATAA
ATTTTGATGCACTCGTTAGCCTCGACACCAGTATCTGCACATAAGAAAAATCAACGGATT
AAAGAAAAATACGAAATCGGAGCTGGGAAAGTGGTAATCGCGAGTAAAGGAAAACAAACA
AGAAGAAGAAATGACTCACCGGCGGGAGAAAATCCGACACGGCGACGCTTCTTAGGCTCG
GTACCCGGACCGGCGGAGGCTTGCTGCTTCTGAACCATGGAGTCCCCGGCGAGTGCAAGG
CGGGAAGAGAGTGAGACAAAGGCGGGAAAATTGGAGGGTTAATGGAAATGCGGAGAGAGC
   
Sequence Name 54-K029745-022-034-H03C-FL67
GenBank Accession LN508367 [GenBank]
Sequencing primer gene specific primer, FL67: 5'-ACTCTCTTGTGTATCGCTCTCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>54-K029745-022-034-H03C-FL67
CATTTTCCGCCTTTGTCTCACTCTCTTCCCGCCTTGCACTCGCCGGGGACTCCATGGTTC
AGAAGCAGCAAGCCTCCGCCGGTCCGGGTACCGAGCCTAAGAAGCGTCGCCGTGTCGGAT
TTTCTCCCGCCGGTGAGTCATTTCTTCTTCTTGTTTGTTTTCCTTTACTCGCGATTACCA
CTTTCCCAGCTCCGATTTCGTATTTTTCTTTAATCCGTTGATTTTTCTTATGTGCAGATA
CTGGTGTCGAGGCTAACGAGTGCATCAAAATTTATCTCGGTGCGTATTTGATTTAAATCA
TTTGAAGTTGACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAA
ACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTC
GGAAATCTTTATTTCGACGTGTCTACTT

Last Updated on 07.07.2016 14:16