SimpleSearch - Line and FST details


Line specific information

 
Line ID 034H03
Vector Used pAC161
Line Availability only available from NASC (N403255)
Segregation Analysis 100:98:70
Confirmed for Hit At5g56740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g56740

 
Sequence (A. th genome BLAST matches underlined)
>53-K029745-022-034-H03C-8409
CTTTCATTGAATATATCCTGTCAACTTCAAATGATTTAAATCAAATACGCACCGAGATAA
ATTTTGATGCACTCGTTAGCCTCGACACCAGTATCTGCACATAAGAAAAATCAACGGATT
AAAGAAAAATACGAAATCGGAGCTGGGAAAGTGGTAATCGCGAGTAAAGGAAAACAAACA
AGAAGAAGAAATGACTCACCGGCGGGAGAAAATCCGACACGGCGACGCTTCTTAGGCTCG
GTACCCGGACCGGCGGAGGCTTGCTGCTTCTGAACCATGGAGTCCCCGGCGAGTGCAAGG
CGGGAAGAGAGTGAGACAAAGGCGGGAAAATTGGAGGGTTAATGGAAATGCGGAGAGAGC
GenBank Accession HG968618 [GenBank]
Graphic View Graphic view of gene At5g56740
Predicted Position of Insertion Chr5:22955320 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MIK19
Hit Gene Code At5g56740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone acetyltransferase of the gNAt family 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL763228 [GenBank] AL763227 [GenBank]


Last Updated on 14.10.2014 10:23