Sequences from confirmation amplicon


Confirmation sequences for line 041A02 and hit At3g51060 are shown.
Line ID 041A02
Locus At3g51060 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:18964292
Primers used for PCR 13wp - 8474, show primer details
   
Sequence Name 32-K118496-0022-041-A02C-13wp
GenBank Accession LN500767 [GenBank]
Sequencing primer gene specific primer, 13wp: 5'-TGGTTATGATTACTTGGTCCAACA-3'
Sequence (A. th genome BLAST matches underlined)
>32-K118496-0022-041-A02C-13wp
AGATCCACCTTTGCTGATGTTGCTGATGCTGAAACTGATCTCTTGCTGATTGTGGTTTTG
CCATAACTCAAGTGTTCCTAAAGCAGCGTTTGACGAAGAAGGAGCGTTTGCGTTAACGTT
TGTGTTTGCGTTTGCGTTAACGTTAGGGTTTCTATACCAGAGCCAAGCTTCTGATACAGG
CGGAGGAGGATTTGTGTTGCTCCGGTGATCTTCTTGGTTGTTACCTCCACCTCCGCCTCC
TCCTCCACCACCGTCTAGCGAGAAAAACCCCGCCATTCACCAAGACAACAACCACCACCC
ATAACCACCACTCACCCACTAACCAATCAAGAAAATGGAACAAAACCCAAAACCAAAGAT
CCTATGTTTTGTAGTTCTATACACTCTAACTTTCTCACTCTAGATCTTAGAGGATTTCTA
GGGTTTTTAGGTTGAATTCATTCTCTGGGTTTGTAGTGTATTGAAGTTGGAATAGCTTTT
TGAGACTCTGATGAAAAAGCAAAACTTGTTTGTCGGTACGAGAGAGAGAGTATTTAAGAA
ACACACAGAGATATGTAAGAAGGAAGAAGAAGAAGAGAGATTTAAATCATTGGCTTCAAT
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCA
   
Sequence Name 08-K118495-0022-041-A02C-8409
GenBank Accession LN489933 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>08-K118495-0022-041-A02C-8409
ATTATTGAAGCCATGATTTAAATCTCTCTTCTTCTTCTTCCTTCTTACATATCTCTGTGT
GTTTCTTAAATACTCTCTCTCTCGTACCGACAAACAAGTTTTGCTTTTTCATCAGAGTCT
CAAAAAGCTATTCCAACTTCAATACACTACAAACCCAGAGAATGAATTCAACCTAAAAAC
CCTAGAAATCCTCTAAGATCTAGAGTGAGAAAGTTAGAGTGTATAGAACTACAAAACATA
GGATCTTTGGTTTTGGGTTTTGTTCCATTTTCTTGATTGGTTAGTGGGTGAGTGGTGGTT
ATGGGTGGTGGTTGTTGTCTTGGTGAATGGCGGGGATTTTCACGCTAGAAGTTTATGAAT
GAGGGGGGGGAAGTGAATGGTAATTGCACTCAAAATTAAGGTTAAACAGAATAGTTTTTT
TTTTTCAAACAACTGGGGATTT

Last Updated on 23.10.2014 13:25