SimpleSearch - Line and FST details


Line specific information

 
Line ID 041A02
Vector Used pAC161
Line Availability only available from NASC (N403842)
Segregation Analysis 100:98:91
Confirmed for Hit F24M12 At3g51060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F24M12

 
Sequence (A. th genome BLAST matches underlined)
>09-K015226-022-041-A02-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAAGCACTTTAGTAGTA
CTATTATCAAAAAGATAATGCAGTAACATAGGGCACCTCAACAAAATCGTACGTTTGTCT
CTATGCCCGTGCCGTGAGCATCATGGATCCTAATTTAACTAATCATTATAATTAGCTGAG
TATTTTTTTAGGTATTATCCTTTGAATTGCCTGAGAATAACGGCACGAAAAAATATGTCC
CGATAAATCCGAAATCTATGGGATCCTCCCTTTAGGTGAGANGNNCTNATCTTNCGGGTC
CGGACTTATTCCTTCCGAGGATTATGTGGACCTTGGCTGGCCTATCCTATTCCACTTCGG
ACCTGTGAGCTGCCCCACTAAGGTTAGAGAACATAGCAGAGAGATACGCCCTATAGCGCG
TAAGAACCATTTTAGTAGCTTGCCACATCTCTCTATCATAAGATCAGACTACTCTTCACC
AGCCCTCTTAATTATCTAAGAAAGTCTCAATGGAAAACTCAGCACTAAGCAACTGTGTGA
GGCGAACAAATTTCTCTAATCAACAGAGAACTATGCAAGAGGGTCTA
GenBank Accession AL763808 [GenBank]
Graphic View Graphic view of sequence AL763808 of line 041A02
Predicted Position of Insertion Chr3:18963258 - go to primer design
BLAST e Value 7e-61
Hit Clone Code (BAC ID) F24M12
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g51060

 
Sequence (A. th genome BLAST matches underlined)
>09-K015219-022-041-A02-8409
NTGATCCATGTAGAATTTCCCGGGACATGAAGCCTTTACAATTATTGGAAGCAATGATTT
AAATCTCTCTTCTTCTTCTTCCTTCTTACATATCTCTGTGTGTTTCTTAAATACTCTCTC
TCTCGTACCGACAAACAAGTTTTGCTTTTTCATCAGAGTCTCAAAAAGCTATTCCAACTT
CAATACACTACAAACCCAGAGAATGAATTCAACCTAAAAACCCTATGGGATCCTCCCTGT
AAGTGAG
GenBank Accession AL763807 [GenBank]
Graphic View Graphic view of gene At3g51060
Predicted Position of Insertion Chr3:18964297 - go to primer design
BLAST e Value 4e-50
Hit Clone Code (BAC ID) F24M12
Hit Gene Code At3g51060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Lateral root primordium (LRP) protein-related
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences

Gene hit K10D20

 
Sequence (A. th genome BLAST matches underlined)
>09-K015226-022-041-A02-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAAGCACTTTAGTAGTA
CTATTATCAAAAAGATAATGCAGTAACATAGGGCACCTCAACAAAATCGTACGTTTGTCT
CTATGCCCGTGCCGTGAGCATCATGGATCCTAATTTAACTAATCATTATAATTAGCTGAG
TATTTTTTTAGGTATTATCCTTTGAATTGCCTGAGAATAACGGCACGAAAAAATATGTCC
CGATAAATCCGAAATCTATGGGATCCTCCCTTTAGGTGAGANGNNCTNATCTTNCGGGTC
CGGACTTATTCCTTCCGAGGATTATGTGGACCTTGGCTGGCCTATCCTATTCCACTTCGG
ACCTGTGAGCTGCCCCACTAAGGTTAGAGAACATAGCAGAGAGATACGCCCTATAGCGCG
TAAGAACCATTTTAGTAGCTTGCCACATCTCTCTATCATAAGATCAGACTACTCTTCACC
AGCCCTCTTAATTATCTAAGAAAGTCTCAATGGAAAACTCAGCACTAAGCAACTGTGTGA
GGCGAACAAATTTCTCTAATCAACAGAGAACTATGCAAGAGGGTCTA
GenBank Accession AL763808 [GenBank]
Graphic View Graphic view of sequence AL763808 of line 041A02
Predicted Position of Insertion Chr3:7179689 - go to primer design
BLAST e Value 4e-75
Hit Clone Code (BAC ID) K10D20
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23