Sequences from confirmation amplicon


Confirmation sequences for line 053A11 and hit At1g65040 are shown.
Line ID 053A11
Locus At1g65040 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24161721
Primers used for PCR JM04 - 8474, show primer details
   
Sequence Name 15-K022051-022-053-A11C-8409
GenBank Accession LN492777 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K022051-022-053-A11C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTCACAACTCACTATCG
CCTTATCGGTATACAGTGTTTGTTGCTGGATACTTGTAGCAAGAGTTACTTGCATAATTC
TATCATTACACTTATGTCCATCTATGAGTCTTCTCTTGGTTACATTAGTACTTTCATATA
TTCTTACTTGTAGACGATGAAAGTCATAAATGAGAAACAATAATCAGCCAAAACAATAGA
TCTACTACGTCAGTCTTTATGCAATTTATGGCAATATAGTATTGGAATTTGTATCCTAAT
TTGAGTATCACTTTTTTATTGCGTAGGAACTATGGCCTTCCCTTGCATCTAATACGGGAG
CTCTACGAAACGTTCAGAAACTTCAAGATTCGTGTGACTGATTACCTTCGATATCGGAAA
ATCACTTCCAATATGAATGATCGGTTTCCTGATGCAACTCCTGAAGAACTTAGTTCGTAA
GTTCCAGATATTCCCACAAGATTTATGTTTCCAAATATTCTAAATATCTTTTGAGCAGTT
TCTTAAAACTAATTATGCTTGTATATCTAGATCAATCACATTTCTTTATTTGGGGTTTGC
AGAAATGATGCCACTTGTATCATATGTCG
   
Sequence Name 16-K022051-022-053-A11C-JM04
GenBank Accession LN493247 [GenBank]
Sequencing primer gene specific primer, JM04: 5'-CTGAGGTCATTTCTTCACGACATA-3'
Sequence (A. th genome BLAST matches underlined)
>16-K022051-022-053-A11C-JM04
GCATCATTTCTGCACCCCCCACATAGAGAAATGTGTTTGATCTACATATACTCGCTTAAT
TTGTTTTCAGAAACTGCGCAAATGATTTGTAAAACATGGGGAAACATATCTCTTGTGGGA
ATCCCTGGAACTTACCAACTAAATTCTTCAGGAGTTGCATCAAGAAACCGATCATTCATA
TTGGAAGTGATTTTCCGATATCGAAGGTAATCAGTCACACCCATCTTGACCTTTCTGAAC
GTTACTCATAGCTCCGGTATAAAATGCAAGGGAA
Primers used for PCR FM12 - 3144, show primer details
   
Sequence Name 25-K029206-022-044-F01C-3144
GenBank Accession LN497308 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K029206-022-044-F01C-3144
TATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGT
ACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGAACTAAT
TTCAGCATGTTAATAATTCAGGATTTAGGTTTCTTTTGGTGGTATAACATCTAAGTTTGG
AATAATGAAAACGTGAATAAACTAAAAACTTACATGAATATCATCAGGAAGAAGCAAAGA
TACATGGACAAGTGAAGCAAGTCACGAACAAGCTCCAGATAGAAAGTGTATACTGGTTTT
CCTTCCCATTGACCTTCCTTGAGCATATCAGTGACATAGAAGGCATACTTCACAATAATA
GAAACAGTTGTTGTTGCCAGAATCATATACCTGCAACATAAAATTCGTAATTAAGTCTAA
AGCTAGGCTGTATGATGCAAAATTCAGTAAGACTAAATTGTCAGAACAAACAGCTAAACA
GGGGGACATATCACATGGTCTATTGATGGCATATCCAAAGAAGGATACATAACTAAACAA
TATGCACCGTAAACAAAGCTAATAACATGAATAAATATCCTGATCTCTTAATCACCTGAG
CCCTTCCCCCATATAT
   
Sequence Name 26-K029206-022-044-F01C-FM12
GenBank Accession LN497785 [GenBank]
Sequencing primer gene specific primer, FM12: 5'-TCGAAAATAGCTGAATATATGGGG-3'
Sequence (A. th genome BLAST matches underlined)
>26-K029206-022-044-F01C-FL91
TTATTCATGTTATTAGCTTTGTTTACGGTGCATATTGTTTAGTTATGTATCCTTCTTTGG
ATATGCCATCAATAGACCATGTGATATGTCCCCCTGTTTAGCTGTTTGTTCTGACAATTT
AGTCTTACTGAATTTTGCATCATACAGCCTAGCTTTAGACTTAATTACGAATTTTATGTT
GCAGGTATATGATTCTGGCAACAACAACTGTTTCTATTATTGTGAAGTATGCCTTCTATG
TCACTGATATGCTCAAGGAAGGTCAATGGGAAGGAAAACCAGTATACACTTTCTATCTGG
AGCTTGTTCGTGACTTGCTTCACTTGTCCATGTATCTTTGCTTCTTCCTGATGATATTCA
TGTAAGTTTTTAGTTTATTCACGTTTTCATTATTCCAAACTTAGATGTTATACCACCAAA
AGAAACCTAAATCCTGAATTATTAACATGCTGAAATTAGTTCAAACACTGATAGTTTAAA
CCGAAGGCGGGAAACGACAATCTGATCCCCGGGTACCCTGTCCTCTCCAAATGAAATGAA
CTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACG
TCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTT
TCCACGATGCTCCTCGTGGGTG

Last Updated on 07.07.2016 14:16