SimpleSearch - Line and FST details


Line specific information

 
Line ID 053A11
Vector Used pAC161
Line Availability only available from NASC (N405003)
Segregation Analysis 100:95:70
Confirmed for Hit At1g65040
Parent of DUPLO pair none
Parent of pair(s) 12114

Gene hit At1g65040

 
Sequence (A. th genome BLAST matches underlined)
>81-K012302-022-053-A11-8409
NGGGTGNGATCCATGATACATTTCTCGNGACATGAAGCCTTTACAATTGAATATATCCTG
CATTTCTATGGGATCCTCCCTATAGTGACAGCGCTNNGTTGCTGGATACTTGTGGCGGGA
TTTACTTGCCTAATTCTATCATTACACTAATGTGCCATCTATGAGTCTTCTCTTGGTTAC
ATTACTACTTTCATATATTCTTACTTGTAGACGATGAGAGTCATAAATGAGAAACATTAA
TCATCCAAAACAATAGATCTACTACGTCAATCTTTATGCACTTTATGGCAATATAGAATG
GGAATTTGTATCCTAATTTGAGTATCACTTTTTTATCAGCGTACGAACTATGGCCTTCCC
TTGCATCTAATACGGGAGCTCTACGAAACGATCATAAACTTCAATATTCAAGTGACTGAT
TACCTTCGATATCGGAAAATCACTTTCAATATGAATGATCGGTTTCCTGATGCAACTCCT
GAAGAACTTAGTTCGTAAGTTCCAGATATTCCCACAAGAGGTATGTTCCCAAATATTCTA
AATATCTCTCGAGCAGTTACTTAAAACTAATTATGCT
GenBank Accession AL753981 [GenBank]
Graphic View Graphic view of gene At1g65040
Predicted Position of Insertion Chr1:24161680 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16G16
Hit Gene Code At1g65040 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL753983 [GenBank]

Gene hit At1g65340

 
Sequence (A. th genome BLAST matches underlined)
>81-K012481-022-053-A11-8409
TGATCCATGTAGATTTCCCGGAAAATCTTACCAATTGATGCAAATTATGAAAGTTTACAT
TGATGTCCCCACCCATAAGTCTTTTTCTAATCAGAATATTTTAGGTGGTGTTATGGGTTA
GTTTGGGTTTATATTTCATAAGTCTTTTTCTAAAGTTTATATCTTAGGTTTAAAGTTTTA
TCGGATTTTAAAAAACATTTGGGTTCATTGAAAGTGAATCATTAATCATTTTGTTAAATA
CGTAGAAGTGTATATTCAACGATACGTGATGTCATTTGGTTTTCTATTATTGAATGAAAT
TTTATAACAAATGATATGGTAATCTAAACAAAATCCAACAAAACTTTTGACCATTTTTTA
TTTTTTTATTTCAAGCTTTTCTACTATTTTAAAGTCTTTTTAAGAAAATATAAGCTAAAA
TTTTGTTCATAAATCTTTCGATAATTCCAAATCAAAACTTTTTAAAAAAAATAAAAGAAA
AATACATGAAAAAACCTTTAAAAAATCATTAAAAAAACATAAATCTACATTTATTTCATT
CTACCTATGGGATC
GenBank Accession AL753986 [GenBank]
Graphic View Graphic view of gene At1g65340
Predicted Position of Insertion Chr1:24269923 - go to primer design
BLAST e Value 2e-172
Hit Clone Code (BAC ID) T8F5
Hit Gene Code At1g65340 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 96, subfamily A, polypeptide 3
Insertion Classification 5' region
Confirmation Status unknown


Last Updated on 14.10.2014 10:23