Sequences from confirmation amplicon


Confirmation sequences for line 054A07 and hit At5g20040 are shown.
Line ID 054A07
Locus At5g20040 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:6771084
Primers used for PCR MM30 - 8474, show primer details
   
Sequence Name 25-K019770-0022-054-A07C-MM30
GenBank Accession LN497240 [GenBank]
Sequencing primer gene specific primer, MM30: 5'-CGATCCATACCCAATTCCTACTAC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K019770-0022-054-A07C-MM30
TTATACGGCTTAATAGAGTCGAACTCCGATAAAAATGATAAAATCAAATAGATTTAAGAA
AATGTAAAATCAAATGAACTTAATCACTTGACTAAAGACACATCCTATAATTTAAATTTT
CGAATATATAGATGGATCGAACCGGTCGAATCCTACCAGCCCGACCATAAAAAACCTAAT
CATAGGACCCTGTAATTGATCAAAAACCATATGTAATTGTTCCATTTTTTGGTTGTGTAA
GTAATTAACACGACATGATAACATCGTTTATAACTGTCTAGGTTTAAGTAAACCGTTTAA
TTTCGGTTCGCTTGTTCGGTTTATGTGTAAACCTAACCGAACCGTAGTTCTCTAATCCCT
TGCTCACTGTCTTCGTCTCTCTTCGAGATGAGCTTTATGAAATGGCTTAACGACAATATT
CAATTATAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTC
AATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTC
CGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGT
ATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGT
CTACATT
   
Sequence Name 26-K019770-0022-054-A07C-8409
GenBank Accession LN497715 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K019770-0022-054-A07C-8409
AGATTTCCCGGACATGAAGCCATTTATAATTGAATATTGTCGTTAAGCCATTTCATAAAG
CTCATCTCGAAGAGAGACGAAGACAGTGAGCAAGGGATTAGAGAACTACGGTTCGGTTAG
GTTTACACATAAACCGAACAAGCGAACCGAAATTAAACGGTTTACTTAAACCTAGACAGT
TATAAACGATGTTATCATGTCGTGTTAATTACTTACACAACCAAAAAATGGAACAATTAC
ATATGGTTTTTGATCAATTACAGGGTCCTATGATTAGGTTTTTTATGGTCGGGCTGGTAG
GATTCGACCGGTTCGATCCATCTATATATTCGAAAATTTAAATTATAGGATGTGTCTTTA
GTCAAGTGATTAAGTTCATTTGATTTTACATTTTCTTAAATCTATTTGATTTTATCATTT
TTATCGGAGTTCGACTCTATTAAGCCGTATAACCTCGCCTATGTAGTAGGAATTGGGATG
GGATCG

Last Updated on 23.10.2014 13:25