SimpleSearch - Line and FST details


Line specific information

 
Line ID 054A07
Vector Used pAC161
Line Availability only available from NASC (N405095)
Segregation Analysis 100:100:74
Confirmed for Hit At5g20040
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g03980 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g03980

 
Sequence (A. th genome BLAST matches underlined)
>49-K012384-022-054-A07-35St
TCTTCTGCCTCTCTCACACAACTCAGTCCCTCTTCGACGGTTTATTGCATCCGCATTTTG
AAGCAACATGAACAGACCTCTGTGCGAACGCTACTCTTTTTTTTTTGTGAAGCATTGCCT
AATTCTTTACGTAATTCATAGAGAGAGAGAGAGAGAGAGCACAGAGATAGATCCTTTCTT
TTACCGCGCCCGCCCCCGCCTCTCTGTTAGTGTGCGCGCCCCTTCGCCCCACACTCACTC
TGTCACTGTGTTTATGGTGCGTGTCTCCCCGCCCTCTCTTCCCCCTGGAGAGATAGATCC
CGGTTGACAAGAAAGAAGTGCGCCCTCTCCCTACTGCTGTCCCTCCATGTACCAGCAGGC
ACACCCAGGACTGACTCTTCCTCACTCTCCACGCCCCCCCCGCCCCTCCACGCAAACTAC
CACCTCAGCCTCGCGCCCTGCCACGCCCACCTCCCTCCCCTATCTCCTCTATCCAT
GenBank Accession AL754315 [GenBank]
Graphic View Graphic view of gene At1g03980
Predicted Position of Insertion Chr1:1022115 - go to primer design
BLAST e Value 7e-21
Hit Clone Code (BAC ID) F21M11
Hit Gene Code At1g03980 [TAIR] [MIPS] [SIGnAL]
Gene Annotation phytochelatin synthase 2
Insertion Classification Promoter
Confirmation Status failed, line belongs to a contamination group, please check line 054B01

Gene hit At5g20040

 
Sequence (A. th genome BLAST matches underlined)
>49-K012427-022-054-A07-8409
GTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTATAATTGAATATTGTCGTTAAGC
CATTTCATAAAGCTCATCTCGAAGAGAGACGAAGACAGTGAGCAAGGGATTAGAGAACTC
CGGTTCGGTTAGGTTTCACATAAACCGAACAAGCGAACCGAAATTAAACGGTTTACTTAA
ACCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACTGGGCTGGGACTCTGACCGGG
TTCTTTATTATTATTCGTGAACTTGAGAGGGGGAGTGGGATCTATGGATCGATCGGGGGG
AGTAGAAGCGTACGCGCCATGGCTGGTGTGCGGATGCTTGTGGGATCCTGCCTCGACGGT
GACTGATGAGTAGATTGTTCTGGCTATTGTACTGACTGATTTGGGATCCTGTCACTTGAG
ATGGGAAACCTTGTTGAGGATAATTGCTAACGGAGAAGTTTTTAGTTTTATCAATTCCAT
AACTTGGGATCTATGGCTGGAGAGGAATAAAAAGGCTTCTTGCTTTTGTTTTACCCGGAT
CTCACGCGTGTTAAGGCCTTGATGTTGGATCAGCCAAGCCATTCAGATAGCGATAGAAAG
GTTTGTTTCTGAAATATTTGGTAAGATTTATTCATTTCTATCTCACGTTGGGGCCGCTCG
TGATCACATTGTATTTGGAAAGTTGTTTGTTTTTCGAATTATTCAGG
GenBank Accession AL754316 [GenBank]
Graphic View Graphic view of gene At5g20040
Predicted Position of Insertion Chr5:6771039 - go to primer design
BLAST e Value 1e-87
Hit Clone Code (BAC ID) F28I16
Hit Gene Code At5g20040 [TAIR] [MIPS] [SIGnAL]
Gene Annotation isopentenyltransferase 9
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23