SimpleSearch - Line and FST details


Line specific information

 
Line ID 054A07
Vector Used pAC161
Line Availability only available from NASC (N405095)
Segregation Analysis 100:100:74
Confirmed for Hit At5g20040
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in F21M11 can not be ordered because the confirmation of this insertion failed.

Gene hit F21M11

 
Sequence (A. th genome BLAST matches underlined)
>49-K012384-022-054-A07-35St
TCTTCTGCCTCTCTCACACAACTCAGTCCCTCTTCGACGGTTTATTGCATCCGCATTTTG
AAGCAACATGAACAGACCTCTGTGCGAACGCTACTCTTTTTTTTTTGTGAAGCATTGCCT
AATTCTTTACGTAATTCATAGAGAGAGAGAGAGAGAGAGCACAGAGATAGATCCTTTCTT
TTACCGCGCCCGCCCCCGCCTCTCTGTTAGTGTGCGCGCCCCTTCGCCCCACACTCACTC
TGTCACTGTGTTTATGGTGCGTGTCTCCCCGCCCTCTCTTCCCCCTGGAGAGATAGATCC
CGGTTGACAAGAAAGAAGTGCGCCCTCTCCCTACTGCTGTCCCTCCATGTACCAGCAGGC
ACACCCAGGACTGACTCTTCCTCACTCTCCACGCCCCCCCCGCCCCTCCACGCAAACTAC
CACCTCAGCCTCGCGCCCTGCCACGCCCACCTCCCTCCCCTATCTCCTCTATCCAT
GenBank Accession AL754315 [GenBank]
Graphic View Graphic view of sequence AL754315 of line 054A07
Predicted Position of Insertion Chr1:1022115 - go to primer design
BLAST e Value 7e-21
Hit Clone Code (BAC ID) F21M11
Insertion Classification Genome Hit
Confirmation Status failed

Gene hit At5g20040

 
Sequence (A. th genome BLAST matches underlined)
>49-K012471-022-054-A07-8409
TTTGATCCATGTAGACTTTCCTGTGACATGAAGCCTTTATAATTGAATATTGGCGTTAAG
CCATTTCATAAAGCTCATCTCGAAGAGAGACGAAGACAGTGAGCAAGGGATTATAGAACT
GCGGTTCGGTTAGGTTTACACATAAACCGAGCAAGCGAACCGAAATTAAACGGTTGTACT
TAAACCTAGCAGGACCCTGGGGATAGGGTTCCAGGTGTGTGCTATACCAACGGTTGATTT
AGTTGTATCTATAGGCAATCTTCATAACTTGACCTGCTTGGAGTACTATTCTAGCCTAAA
GCAGTAGACGCGTAACTGGTGGCTATTTAAAAAGAGCGAGATGGCGCGATGAGGATATGG
GGACGTCCAGACGAGAGCAATGGATTCAGGGTCTGACCGTGATATACAGCACACAATGCA
GTGGAGGCAATCTGTTGGTACGGATTGACAGACTACGCCGTAAGACAGTTTAGACTCCGA
CTTCGCTTTGGGATATGGGATACATGCGTANAGAGAGGGACNNNGCTACCGACCACCCCA
CTCCCAGGTGTATAAAGGGCCTTGATGTTGGATCAGCCAAGCCTTTAGATATCGATAGAA
AGGGATGTTTCTGAAATATATGGGAAGAATGATTCCTTTTTATCTCACGGTGGGGCCGCT
CGGGAACACATTGCACTGGAAGGTTGATGTCTTACAAATTATTTAGGGGGAGGCCTATCA
TTCTTATCAACATTTGGCCTTCCGTCCAAAGGATTAGCCGACTTTGTTGCTATTGCAAAT
GCC
GenBank Accession AL754318 [GenBank]
Graphic View Graphic view of gene At5g20040
Predicted Position of Insertion Chr5:6771073 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) F28I16
Hit Gene Code At5g20040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation isopentenyltransferase 9
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754314 [GenBank] AL754313 [GenBank] AL754313 [GenBank]


Last Updated on 31.08.2016 09:40