Sequences from confirmation amplicon


Confirmation sequences for line 058D11 and hit At4g11560 are shown.
Line ID 058D11
Locus At4g11560 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:7001594
Primers used for PCR MK65 - 8474, show primer details
   
Sequence Name 82-K101329-0022-058-D11C-8409
GenBank Accession LN514164 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>82-K101329-0022-058-D11C-8409
CCATTTACATTGAATTGAAAGGTCTTAGCTAAACGTTTCAATCATTTTTATCACGCTAAA
TATTCTCCCTCTTCATACAGTCACCTTTCACATTTCTTCCTACCAAAATTGACCAAATTA
CCTGCTATTTAGAATTCAGTAATTGGTGGAATAACTCTTTTGTTTAAACTGATTGACAGG
ATGAGAAATTTCTCTGGCCAGATGCTGCTGTTCCTCAAGTGTGTGCTCTTGAGAATGCTT
CACATGCTTCTCTTGCATCGGATTTTCAGAAATATAACCAAAAGATGAGGACACTGGTTT
TCAATCTCAAGGTTATAGAATCTGCATTCATGCCATTACATTACTTTTTCCCCTAATTTT
CTACTCTTGATTCTNTGATCATACAGTTTGTGCCTGTATGCTCCGTTTTTAAGACAGTTG
ATATATGAATTTCATGAGACATGGTAAAATTTGAATACCTTAGGAATGGTTTATTACTGG
AGGTTCTCAGTTTGTCTATNTTTGTGAGCCTGTGTGAAGGTTCTCAGTTTGTTGTAAAAA
TCACTTCAGCGTTTC
   
Sequence Name 82-K101335-0022-058-D11C-MK65
GenBank Accession LN514165 [GenBank]
Sequencing primer gene specific primer, MK65: 5'-AAAATACTTGGAAGAAACGCTGAA-3'
Sequence (A. th genome BLAST matches underlined)
>82-K101335-0022-058-D11C-MK65
ACAGGCTCACAAATATAGACAAACTGAGAACCTCCAGTAATAAACCATTCCTAAGGTATT
CAAATTTTACCATGTCTCATGAAATTCATATATCAACTGTCTTAAAAACGGAGCATACAG
GCACAAACTGTATGATCAAAGAATCAAGAGTAGAAAATTAGGGGAAAAAGTAATGTAATG
GCATGAATGCAGATTCTATAACCTTGAGATTGAAAACCAGTGTCCTCATCTTTTGGTTAT
ATTTCTGAAAATCCGATGCAAGAGAAGCATGTGAAGCATTCTCAAGAGCACACACTTGAG
GAACAGCAGCATCTGGCCAGAGAAATTTCTCATCCTGTCAATCAGTTTAAACAAAAGAGT
TATTCCACCAATTACTGAATTCTAAATAGCAGGTAATTTGGTCAATTTTGGTAGGAAGAA
ATGTGAAAGGTGACTGTATGAAGAGGGAGAATATTTAGCGTGATAAAAATGATTGAAACG
TTTAGC

Last Updated on 23.10.2014 13:25