SimpleSearch - Line and FST details


Line specific information

 
Line ID 058D11
Vector Used pAC161
Line Availability only available from NASC (N405519)
Segregation Analysis 50:50:46
Confirmed for Hit At4g11560 At5g52130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g11560

 
Sequence (A. th genome BLAST matches underlined)
>84-K016087-022-058-D11-8409
TATCATGAAATTTCCCGGACTGAAGCCTTTAAATTGAATATATCCTGATGATTCATCTGA
CGACAGTACTCATTCTCTTCCTCCTGATGTTAACATCGATCCTGATAATATGACTTATGA
AGTATATATTTAGACATAATTAATAATGTTGTCTATCAATTTCTATTGTAATATAAAAAA
GGTATGATGGCTTAACTCTTGTTTGGATGATTTAGGAACTGAATCAATTAGGAGAATCGA
TCGGAGCAGTCAACAAAGGATTGTCGAAGAGGAGAATTGGCCAAATACCAACTCATAAAT
TTACCTCGTCGCCTATGGGATCCTCCCTAATAGTGAGATTATANAATCTGCATTCATGCC
ATTACATTACTTTTTCCCCTAATTTTCTACTCTTGATTCTTTGATCATACAGTTTGTGCC
TGTATGCTCCGTTTTTAAGACAGTTGATATATGAATTTCATGAGACATGGTAAAATTTGA
ATACCTTAGGAATGGTTTATTACTGGAGGTTCTCAGTTTGACTATATTTGTGAGCCTGTG
TGAAGGTTCTCAGATTGTTGTAAAAATCACTTCAGCGTTTCTTCCAAGTATTTTATTGTA
ATTTCATTTGGGTTTTGTCTGCAGAACACTGCACTGCTCACTATGGGAT
GenBank Accession AL936729 [GenBank]
Graphic View Graphic view of gene At4g11560
Predicted Position of Insertion Chr4:7001578 - go to primer design
BLAST e Value 2e-157
Hit Clone Code (BAC ID) F25E4
Hit Gene Code At4g11560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation bromo-adjacent homology (BAH) domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936728 [GenBank]

Gene hit At5g52130

 
Sequence (A. th genome BLAST matches underlined)
>84-K016087-022-058-D11-8409
TATCATGAAATTTCCCGGACTGAAGCCTTTAAATTGAATATATCCTGATGATTCATCTGA
CGACAGTACTCATTCTCTTCCTCCTGATGTTAACATCGATCCTGATAATATGACTTATGA
AGTATATATTTAGACATAATTAATAATGTTGTCTATCAATTTCTATTGTAATATAAAAAA
GGTATGATGGCTTAACTCTTGTTTGGATGATTTAGGAACTGAATCAATTAGGAGAATCGA
TCGGAGCAGTCAACAAAGGATTGTCGAAGAGGAGAATTGGCCAAATACCAACTCATAAAT
TTACCTCGTCGCCTATGGGATCCTCCCTAATAGTGAGATTATANAATCTGCATTCATGCC
ATTACATTACTTTTTCCCCTAATTTTCTACTCTTGATTCTTTGATCATACAGTTTGTGCC
TGTATGCTCCGTTTTTAAGACAGTTGATATATGAATTTCATGAGACATGGTAAAATTTGA
ATACCTTAGGAATGGTTTATTACTGGAGGTTCTCAGTTTGACTATATTTGTGAGCCTGTG
TGAAGGTTCTCAGATTGTTGTAAAAATCACTTCAGCGTTTCTTCCAAGTATTTTATTGTA
ATTTCATTTGGGTTTTGTCTGCAGAACACTGCACTGCTCACTATGGGAT
GenBank Accession AL936729 [GenBank]
Graphic View Graphic view of gene At5g52130
Predicted Position of Insertion Chr5:21182837 - go to primer design
BLAST e Value 2e-147
Hit Clone Code (BAC ID) MSG15
Hit Gene Code At5g52130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936728 [GenBank]


Last Updated on 31.08.2016 09:40