Sequences from confirmation amplicon


Confirmation sequences for line 062E05 and hit At1g11610 are shown.
Line ID 062E05
Locus At1g11610 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:3909608
Primers used for PCR ZZ57 - 8474, show primer details
   
Sequence Name 21-K021643-022-062-E05C-8409
GenBank Accession LN495481 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K021643-022-062-E05C-8409
CATTTACAATTGAATATATCCATCGCTTTTTTCTCATTTTATAATAGTGAGAAATTGTCC
ATAGTATGATTCCTATAGTCAGTGGCTATCGTCAGTGGCTACTTTTCAAATAGGAATTGT
CCATACGTTGAAGAGTAAAAAAGTACTATAGTCAGTGGCTCAGTGCCAGTGGGCAACTAT
ATCTAGTCGTCTTTTTTGAACAACTAATCCTTGCATTTTGGTCATTTCATTTCTTCATTT
TATTCTCTGCTCTTACCTTAGCTTGTTGGGCCTGAGGCCTTTTCTGATTTTGCTTCTGGA
   
Sequence Name 22-K021643-022-062-E05C-ZZ57
GenBank Accession LN495929 [GenBank]
Sequencing primer gene specific primer, ZZ57: 5'-AATCCAGAGCAAAAATCAGAAAAG-3'
Sequence (A. th genome BLAST matches underlined)
>22-K021643-022-062-E05C-ZZ57
AGCTAGGTAGAGCAGAGAAAAAATGAAGAAATGAAATGACCAAAATGCAAGGATTAGTTG
TTCAAAAAAGACGACTAGATATAGTTGCCCACTGGCACTGAGCCACTGACTATAGTACTT
TTTTACTCTTCAACGTATGGACAATTCCTATTTGAAAAGTAGCCACTGACGATAGCCACT
GACTATAGGAATCATACTATGGACAATTTCTCACTATTATAAAATGAGAAAAAACGATGG
ATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGAT
CCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTC
GACGTGTCTACATTC

Last Updated on 07.07.2016 14:16