SimpleSearch - Line and FST details


Line specific information

 
Line ID 062E05
Vector Used pAC161
Line Availability only available from NASC (N405909)
Segregation Analysis 50:46:36
Confirmed for Hit F25C20
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F25C20

 
Sequence (A. th genome BLAST matches underlined)
>37-K016090-022-062-E05-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCATCGTTTTTTCTCA
TTTTATAATAGTGAGAAATTGTCCATAGTATGATTCCTATAGTCAGTGGCTATCGTCAGT
GGCTACTTTTCAAATAGGAATTGTCCATACGTTGAAGAGTAAAAAAGACTATAGTCAGTG
GCTCAGTGCCAGTGGGCAACTATATCTATGGGATCCTCCTCGATAGAGAGATCCTTGCAT
TTTGGTCATTTCATTTCTTCATTTTATTCTCTGCTCTTACCTTAACTTGTTGGGCCTGAG
GCCTTTTCTGATTTTTGCTCTGGATTATTTCTTTTGTGTTTGGGCTTGTAGCCGTCATAA
GCCATTCGGCCTTGCAATTACCCCTTTTTAATGGGGAAAAAAAATGTTTGTGTACGTTAG
TAATATATAACACTACAGTTATTTTTTGTTAATTCATATTTAACTGTTACGACAAAAAAA
AAAAAAAAAAACCCTTTTTAGGGGTTTCCTTAAAACCCAGAAAAAAAATTTCCTTTGGG
GenBank Accession AL936955 [GenBank]
Graphic View Graphic view of sequence AL936955 of line 062E05
Predicted Position of Insertion Chr1:3909600 - go to primer design
BLAST e Value 5e-176
Hit Clone Code (BAC ID) F25C20
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences


Last Updated on 07.07.2016 14:03