SimpleSearch - Line and FST details


Line specific information

 
Line ID 062E05
Vector Used pAC161
Line Availability only available from NASC (N405909)
Segregation Analysis 50:46:36
Confirmed for Hit At1g11610
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g11610

 
Sequence (A. th genome BLAST matches underlined)
>37-K016090-022-062-E05-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCATCGTTTTTTCTCA
TTTTATAATAGTGAGAAATTGTCCATAGTATGATTCCTATAGTCAGTGGCTATCGTCAGT
GGCTACTTTTCAAATAGGAATTGTCCATACGTTGAAGAGTAAAAAAGACTATAGTCAGTG
GCTCAGTGCCAGTGGGCAACTATATCTATGGGATCCTCCTCGATAGAGAGATCCTTGCAT
TTTGGTCATTTCATTTCTTCATTTTATTCTCTGCTCTTACCTTAACTTGTTGGGCCTGAG
GCCTTTTCTGATTTTTGCTCTGGATTATTTCTTTTGTGTTTGGGCTTGTAGCCGTCATAA
GCCATTCGGCCTTGCAATTACCCCTTTTTAATGGGGAAAAAAAATGTTTGTGTACGTTAG
TAATATATAACACTACAGTTATTTTTTGTTAATTCATATTTAACTGTTACGACAAAAAAA
AAAAAAAAAAACCCTTTTTAGGGGTTTCCTTAAAACCCAGAAAAAAAATTTCCTTTGGG
GenBank Accession AL936955 [GenBank]
Graphic View Graphic view of gene At1g11610
Predicted Position of Insertion Chr1:3909600 - go to primer design
BLAST e Value 5e-176
Hit Clone Code (BAC ID) F25C20
Hit Gene Code At1g11610 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 71, subfamily A, polypeptide 18
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936956 [GenBank]


Last Updated on 14.10.2014 10:23