Sequences from confirmation amplicon


Confirmation sequences for line 062E06 and hit At3g09910 are shown.
Line ID 062E06
Locus At3g09910 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:3037025
Primers used for PCR IM02 - 8474, show primer details
   
Sequence Name 13-K024135-022-062-E06C-IM02
GenBank Accession LN491861 [GenBank]
Sequencing primer gene specific primer, IM02: 5'-GAGTTTTTGGAACGTGTGTAGTTG-3'
Sequence (A. th genome BLAST matches underlined)
>13-K024135-022-062-E06C-IM02
CAAAACTCATGGTCCATGTGATTTCTTGTTTGTGATTGTTGTGTAGCTGGACAAGAAAAG
TTCAGAACATTGACAAGTTCTTATTTCAGAGGCTCCCAAGGAATCATTCTCGGTAATGAT
ATATGAGATCATATAATTGTCAGTAGCTGTTGTCGTAATAAGTTCTCAAGACTTGTATTA
ATACTCTCTCCGGATTTTCTTGGTCATGGTGCAGTTTATGATGTCACGAAAAGAGAGACA
TTTTTGAACTTGGCAGATATTTGGGCTAAAGAGATTGAGCTATATTCGACTAACCATGAC
TGCATTAAGATGCTCGTTGGCAACAAAGTTGATAGAGTGAGTAGCAGTAGTAGTAACACT
TGTAGTCAAACAACTTGAGATCGGTTTCACTGATAGTTGTCATTGCAGGAATCAGAAAGG
AAGGTTAGCCGGGAAGAAGGAATGGCTCTAGCGAAAGACCTCAATTGTTTGTTTCATGAA
TGTAGCGCAAGAACCCGAGAAAACGTGAACGGATGCTTCGAAGAGCTAGCTTTGAAGGTA
AGAAAGAATCTTGATGATCCCTAGGATATATTATCGGACAGGATATATTCAATTGTAAAT
GGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCANATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATG
   
Sequence Name 14-K024135-022-062-E06C-8409
GenBank Accession LN492331 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K024135-022-062-E06C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTCCGATAATATATCC
TAGGGATCATCAAGATTCTTTCTTACCTTCAAAGCTAGCTCTTCGAAGCATCCGTTCACG
TTTTCTCGGGTTCTTGCGCTACATTCATGAAACAAACAATTGAGGTCTTTCGCTAGAGCC
ATTCCTTCTTCCCGGCTAACCTTCCTTTCTGATTCCTGCAATGACAACTATCAGTGAAAC
CGATCTCAAGTTGTTTGACTACAAGTGTTACTACTACTGCTACTCACTCTATCAACTTTG
TTGCCAACGAGCATCTTAATGCAGTCATGGTTAGTCGAATATAGCTCAATCTCTTTAGCC
CAAATATCTGCCAAGTTCAAAAATGTCTCTCTTTTCGTGACATCATAAACTGCACCATGA
CCAAGAAAATCCGGAGAGAGTATTAATACAAGTCTTGAGAACTTATTACGACAACAGCTA
CTGACAATTATATGATCTCATATATCATTACCGAGAATGATTCCTTGGGAGCCTCTGAAA
TAAGAACTTGTCAATGTTCTGAACTTTTCTTGTCCAGCTACACAACAATCACAAACAAGA
AATCACATGGACCATGAGTTTTGTAGTAACCAACTACACAC

Last Updated on 07.07.2016 14:16