SimpleSearch - Line and FST details


Line specific information

 
Line ID 062E06
Vector Used pAC161
Line Availability only available from NASC (N405910)
Segregation Analysis 50:50:36
Confirmed for Hit At3g09910
Parent of DUPLO pair none
Parent of pair(s) 6392, 6393, 86537, 86813
Note Although the line exists, the insertion in At5g38430 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g09910

 
Sequence (A. th genome BLAST matches underlined)
>14-K024135-0022-062-E06C-8409
NNNGGGTCATNCNNNNNNTTGGTGACCATGTAGATTTCCCGGACATGAAGCCATTTACAA
TTGAATATATCCTGTCCGATAATATATCCTAGGGATCATCAAGATTCTTTCTTACCTTCA
AAGCTAGCTCTTCGAAGCATCCGTTCACGTTTTCTCGGGTTCTTGCGCTACATTCATGAA
ACAAACAATTGAGGTCTTTCGCTAGAGCCATTCCTTCTTCCCGGCTAACCTTCCTTTCTG
ATTCCTGCAATGACAACTATCAGTGAAACCGATCTCAAGTTGTTTGACTACAAGTGTTAC
TACTACTGCTACTCACTCTATCAACTTTGTTGCCAACGAGCATCTTAATGCAGTCATGGT
TAGTCGAATATAGCTCAATCTCTTTAGCCCAAATATCTGCCAAGTTCAAAAATGTCTCTC
TTTTCGTGACATCATAAACTGCACCATGACCAAGAAAATCCGGAGAGAGTATTAATACAA
GTCTTGAGAACTTATTACGACAACAGCTACTGACAATTATATGATCTCATATATCATTAC
CGAGAATGATTCCTTGGGAGCCTCTGAAATAAGAACTTGTCAATGTTCTGAACTTTTCTT
GTCCAGCTACACAACAATCACAAACAAGAAATCACATGGACCATGAGTTTTGTAGTAACC
AACTACACACGTTCNNAAAACTCAAGGGNNNNGGGTGATTTCTTGTTTGTGATTGTTGTG
TAGCTGGGACAAGAAAAGTTCAGAACCATTTCCAAGTTCTTTTTTCANTGGCCCCAAAAA
AAAAAAATTCCCCTCCCCTCTTTTTTTTTTTTTTCTATTACCCATTCAAAATAAATTCTT
TATAACTTTTAAAAACAATTTTATTTCCTTACAAANCACCCCTTTTTCACTCCTCCTCAC
AATACCCNNNNNTATTTCCTTTTCTCTTTTTTT
GenBank Accession HE664258 [GenBank]
Graphic View Graphic view of gene At3g09910
Predicted Position of Insertion Chr3:3037025 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F8A24
Hit Gene Code At3g09910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RAB GTPase homolog C2B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g38430

 
Sequence (A. th genome BLAST matches underlined)
>45-K016090-022-062-E06-8409
CTGCCCCATAATATATCCTATCGGATCTACAGGATTCTTTCTTACCTTCAGAGCTATGTC
TTCCTCGCATACCGTCGCGCGATTTCTCGGGTTCTTGCGCTACATGTACATGAAAGGATC
ACATTGAGGTCTTTCGCTATGGGATACCTCCCTATAGCGAGATTCTACGGTGCAATCGGC
CGCGGTGGCTCCATTCGGCGGCCTCAAATCCATGACTGGATTCCCAGTTAAGAAGGTCAA
CACTGACATTACTTCCATTACAAGCAATGGTGGAAGAGTAAAGTGCATGGTGACGGTGTT
CGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTATGGGATCC
CCCCTATAGCGAGA
GenBank Accession AL936957 [GenBank]
Graphic View Graphic view of gene At5g38430
Predicted Position of Insertion Chr5:15385264 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) MXI10
Hit Gene Code At5g38430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribulose bisphosphate carboxylase (small chain) family protein
Insertion Classification TS2TE (5')
Confirmation Status failed


Last Updated on 07.07.2016 14:03