Sequences from confirmation amplicon


Confirmation sequences for line 064B11 and hit At4g20140 are shown.
Line ID 064B11
Locus At4g20140 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:10887853
Primers used for PCR AB77 - 8474, show primer details
   
Sequence Name 33-K011908-0022-064-B11C-3144
GenBank Accession LN500780 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K011908-0022-064-B11C-3144
ATTTACATTGCGAGAGATAAACTCATAGATCCAAAGCTTAAGCTTTTTTTGCCATTTGAG
GAAGACGCAGCTTGTCAGGTGCTTGAGATTGCACTTCAGTGCACAAAAACTTCTCCCCAA
GAGAGACCATCTTCTAGGCAAGCTTGTGATAGTCTTCTCCATGTCTACAACAACAGAACG
GCCGGTTATAAGAAGCTGTAAAAAAACTGACACCTGCAAATGTCTTTGGAGACATGAAAA
CTGCCAACTTTAAATTTTTTCTTCTGAAATTCTGTTTCTGCTTTGTATAGATGACATGGT
TTCTTTCAGTACAAAGATTGTTTCGAACTTGATCCATCTGCTACAAAAACACTTATTGTC
TTTTGCATGTACTTGTAATACAACTTAAACCAAATTTTAAACAGAATGATTCTGATTCTG
ATTCTGAAACTCTATTCTCATAACAGAAGGTAGATTGCAAGGTTTATCATTTCGCCATTA
TTAACCAGATACAAACAGATTCAGATTGTGAAAACACAAATCTTTAGGTTCATATTCGAA
AACAGTGAATGAAAAGAACTCCAGAGCTGAAGTCAAAGAGAAGGAGAAGAAACGCTTATA
CAGGAAAGATCAGACAAAACAAGCACTTGAGATGAGTTCAGGGGAAGATATTTCTTTTCT
GAAGACTTCAAAGATCACGCAAA

Last Updated on 23.10.2014 13:25