SimpleSearch - Line and FST details


Line specific information

 
Line ID 064B11
Vector Used pAC161
Line Availability only available from NASC (N406071)
Segregation Analysis 39:37:35
Confirmed for Hit At4g20140
Parent of DUPLO pair 2571
Parent of pair(s) none

Gene hit At4g20140

 
Sequence (A. th genome BLAST matches underlined)
>82-K025917-022-064-B11-8409
GGAAGAAGACTTTAGATTGAAGTGTTTACGCATGGAACCCTCCCTATAGTGCTTGTGCGA
TTTGAGGAGGACGATGCTAGCCAGGGGGTTGAGAGTGCATTTCACTGCCGAGTAAGTTCT
CCCCGCGAGAGACGATCTTCTAAGCAAGCTTGTGATAGTCTTCTCCATGTCTACAACAAC
AGAACGGCCGGTTATAACAAGCTGTAAAAAAACTGACACCTGCAAATGTCTTTGGAGACA
TGAAAACTGCCAACTTTAAATTTTTTCTTCTGAAATTCTGTTTCTGCTTTGTATAGATGA
CATGGTTTCTTTCAGTATGGGATCCTCCCTATAGTGAGANNNNNNNNNNNNNANNNNNNN
NNNNNATGCTTTTTGGAAATNCAAAATTTTNCGTNTAAAAAAAATAATAATATATAAAGG
GTGGGATTGAAAANTTAAAAAATTAGGGGCTTATNTTTGTTTGNNAAAATAATAAAAATT
ATGTGGTGGTGGGGAAAATTTTGAATAAAGTTA
GenBank Accession CR396112 [GenBank]
Graphic View Graphic view of gene At4g20140
Predicted Position of Insertion Chr4:10887882 - go to primer design
BLAST e Value 1e-85
Hit Clone Code (BAC ID) F1C12
Hit Gene Code At4g20140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat transmembrane protein kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755024 [GenBank] CR396113 [GenBank]


Last Updated on 31.08.2016 09:40