Sequences from confirmation amplicon


Confirmation sequences for line 065H09 and hit At5g40420 are shown.
Line ID 065H09
Locus At5g40420 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:16173512
Primers used for PCR LL04 - 8474, show primer details
   
Sequence Name 63-K023021-022-065-H09C-8409
GenBank Accession LN510886 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>63-K023021-022-065-H09C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATAATAATATGCTGATCCACGGTT
CAACAAAAAGCCAAACAAAAAAAACACATAACATCATATTGAAAATGCAGAAAAAACGAC
ATAATAGTGAAAACACATATCTACCGTTCATACTGAAAACTCATCATGCAGCCGTCGTCC
TCCCCTGAGTCTCATGACCCTTAGTGGTAGTGTCATGTGGCTTAGAAATATCATATTGTT
TAACATCTTGGGCCTTGTTCTGCACATGCTGGCCCATTTCTTTGCCCTTTTGTCCTGCGT
AGCCAACCGCATCAGCCATTCTCCTCTTAGCATACTCCAATTGCTC
   
Sequence Name 64-K023021-022-065-H09C-LL04
GenBank Accession LN511105 [GenBank]
Sequencing primer gene specific primer, LL04: 5'-CTGAGCAATTGGAGTATGCTAAGA-3'
Sequence (A. th genome BLAST matches underlined)
>64-K023021-022-065-H09C-LL04
AATGGCTGATGCGGTTGGCTACGCAGGACAAAAGGGCAAAGAAATGGGCCAGCATGTGCA
GAACAAGGCCCAAGATGTTAAACAATATGATATTTCTAAGCCACATGACACTACCACTAA
GGGTCATGAGACTCAGGGGAGGACGACGGCTGCATGATGAGTTTTCAGTATGAACGGTAG
ATATGTGTTTTCACTATTATGTCGTTTTTTCTGCATTTTCAATATGATGTTATGTGTTTT
TTTTGTTTGGCTTTTTGTTGAACCGTGGATCAGCATATTATTATATTCAATTGTAAATGG
CTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAA
AGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTA
TAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAA
AGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCAC

Last Updated on 07.07.2016 14:16