SimpleSearch - Line and FST details


Line specific information

 
Line ID 065H09
Vector Used pAC161
Line Availability only available from NASC (N406237)
Segregation Analysis 8:8:8
Confirmed for Hit At5g40420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g40420

 
Sequence (A. th genome BLAST matches underlined)
>72-011560-strizhov-H9-oriL
TTGATCCATGTAGTATTTCCCGGACCATGAAGCATTTACAATTGAATATATCCTGACTGA
GTATCTCGAGTTCATTCTTAGCAAATCCTGAGGTCTGGTACCAGAATATTGACCTAGTAC
TTAGTTTACCTAATAGAGAGAGAGAACCTCTCCACGATGTACCTGAGGAGAAAATCGCTC
ACGAAGTGTCCAATGTGAATCTCTATGGCCTCCTCCCTATAGTGAGGCGTCTTACTCATA
TCTTATCGTTTAACATCTTGGGCCTTGTTGTGCACATGCTGGCCCATTTCTTTGCCCTTT
TGTCCTGCGTAACCAACCGCATCATCCCTTCTCCTCTTAGCATACTCCAATTGCTCAGGC
ACAGTTCTCCTTGTCCCACGAAGATAGTTCATGACCCCTGAGATTGAGCTAAGCCCGGTT
AGACCGAACATCCCCGAGGCTAAAAAGCCTGTCATTGCAAGCCCGATAGTTAGAGCCGCT
GGGACTATAACCGGGCTGAAGAGGAGAAATAGTGGTAAAGCAACCATTAAGCCGATCACC
GAACCAGCTATGGGATCCTCCCTATAGTGAGTCGT
GenBank Accession AL755127 [GenBank]
Graphic View Graphic view of gene At5g40420
Predicted Position of Insertion Chr5:16173507 - go to primer design
BLAST e Value 7e-160
Hit Clone Code (BAC ID) MPO12
Hit Gene Code At5g40420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation oleosin 2
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755128 [GenBank]


Last Updated on 31.08.2016 09:40