Sequences from confirmation amplicon


Confirmation sequences for line 067A01 and hit At5g46210 are shown.
Line ID 067A01
Locus At5g46210 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:18736782
Primers used for PCR PG08 - 8474, show primer details
   
Sequence Name 24-K021852-022-067-A01C-PG08
GenBank Accession LN496824 [GenBank]
Sequencing primer gene specific primer, PG08: 5'-AAACTCACACAAAACTTCCATCAA-3'
Sequence (A. th genome BLAST matches underlined)
>24-K021852-022-067-A01C-PG08
ATCACGAACCTTACAATTGTATCATTTCAAATCAATCCAGAGCATCAATTGCACAGTAGA
GTAAAAGACCCAAATCAAATCCTAAGATTACGATCAAAATCGTAAAGATGAAAGAAATCG
AAATCGAGCGAAACCTTTATTGAGCTTGATTACAAACTTCTTAGTAGGTTGCGGAAGTGT
AGCTTTCTTCCGAGAGAGATTAGCGGCGGCGGGAGTTGGATCTTCCTCCATATGAAAGCC
AACAACCTTGTCGGCGGTATTAGGGTGTTGAGGGGAATGGTGGAGGTCGTTTTTGGCCTT
TTTCATCGGAGGAGAAGAGTAAGAAGAGTCGTCGGAGGCAGAAGCGGCGGAGAAAGTAGA
GCGTTTGGTAGGAAGAGACATGAAAATGGGTGAAAATTGTGTGAGAGAATCACGAAGAGG
AAGAAGAAGACATCAATCCTAAATAATAACAACCCTTTCTCTCTACCAAAAGCGCACTGT
GCACTCTCTCTCTTTTTTTTTTTGCTCAAATCAGGATATATTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCACCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAAATGTCCGCAGCGTTATTATAAAA
TGAAAGTACTTTTTGATAAAACGACAAATTACGATCCGTCGTATTTATGGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
   
Sequence Name 23-K021852-022-067-A01C-8409
GenBank Accession LN496382 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K021852-022-067-A01C-8409
AGCCATTTACAATTGAATATATCCTGATTTGAGCAAAAAAAAAAAGAGAGAGAGTGCACA
GTGCGCTTTTGGTAAAAAAAAAGGGTTGTTATTATTTAGGATTGATGTCTTCTTCTTCCT
CTTCGGGATTCTCTCACACAATTTTCACCCATTTTCATGTCTCTTCCTACCAAACGCTCT
ACTTTCTCCGCCGCTTCTGCCTCCAACAACTCTTCTTACTCTTCTCCTCCGATGAAAAAG
GCCAAAAACGACCTCCACCATTCCCCTCAACACCCTAATACCGCCAACAAGGTTGTTGGC
TTTCATATGGAGGAAAATCCAACTCCCGCCGCCGCTAATCTCTCTCGGAAAAAAGCTACA
CTTCCGCAACCTACTAAAAAGTTTGTAATCAAGCTCAATAAAGGTTTCGCTCGATTTCAA
TTTCTTTCATCTTTACAATTTTGATCGTAATCTTAGGATTTGATTTGGGTCTTTTACTCT
ACTGTGCAATTGATGCTCTGGATTGATTTGAAATGATACAATTGTTAAGGTTCGTGATTT
TTAGGGTTTTCATTGGCTTGCGATTGATGGAA

Last Updated on 07.07.2016 14:16