SimpleSearch - Line and FST details


Line specific information

 
Line ID 067A01
Vector Used pAC161
Line Availability only available from NASC (N406337)
Segregation Analysis 100:97:81
Confirmed for Hit At5g46210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g46210

 
Sequence (A. th genome BLAST matches underlined)
>01-011693-strizhov-A1-oriL
NCGTAGGATCCATGTAGACTTTCCTGGACATGAAGCCATTTACAAACGCATTATATCCTA
TACCACAGGCTGAAAACTACAACCTGATGCCCGGAAACTACAATCCTATCCTATAGGGAT
TGGATTCTCTCTATAGTGAGTCGTATTACTCACCCNNTNGGGGATTCTTTCCCACAATTT
TAACCCTTTTTAATGTTTTTTCTTACCAAACCCTTTATTTTTTCCGCCGTTTTTGCCTCC
GAGAACTTTTTTTATTTTTTTCCTCCGAGGAAAAAGGCAAAAAACGACCTCCACCTTTCC
CTTTAACCCCTTAATACCGCCGACAAGGTTGTTGGTTTTCATTTGGGGGAAAATCCAACT
CCCCCCCCCGTTATTTTTTTTCGGAAAAAAGTTACTTTTCCGAAACCTATTAAAAAGTTT
GTAATCAACCTCAAAAAAGGTTTCGCTCGATTTCAATTTTTTTCATTTTTACCATTTTGA
TCGTAATCTTAGAGATAGATTTGGGTTTTTTACTTTACTGGGCAATTGATGCTTTGGATT
GATTGAAAATGAAACAATTGGTAAGGGTTCGGAATTTTTAAGGTTTCTATTTGCTTTCCA
AATGAATGAAGTTTTTGTGAGATTTTTAGTTTAAAAATCCACGGGAAAAATTGGGTGGGA
CTTGTGAATTTTTGAAGGAATAAAAGA
GenBank Accession AL755179 [GenBank]
Graphic View Graphic view of gene At5g46210
Predicted Position of Insertion Chr5:18736787 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) MCL19
Hit Gene Code At5g46210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cullin4
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40