Sequences from confirmation amplicon


Confirmation sequences for line 070G07 and hit At1g77490 are shown.
Line ID 070G07
Locus At1g77490 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:29119183
Primers used for PCR LG01 - 8474, show primer details
   
Sequence Name 25-K023494-022-070-G07C-8409
GenBank Accession LN497266 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K023494-022-070-G07C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAACTTGAGCCATTTCACTGTCCATGACTGT
CCTCCTGCTTCTCCAGGTCCAGTTTTCTGCCATTTTGAACGTTTCCATAACATCTCTCTA
CACTATCATCCCTAGAACTATATATAAGGTAGCTTCAGTTTGTCGTTTATTAATACCGTG
TACTTTGTCTCAGGTTTTCCCCAACCACTACGGTCTGGTCTGGCTCTCCCTAAGGTATGT
GCACCAGACAAGGCAACTATTTCCTGTTTGTCAAAAAGAATATTCAGAATAACAAAAATA
TTCACGTTTGACATGAATAACACAAAAGAGAACAAAATCAAAATAACCTTGTCATCAAGT
CCCATTCTGTAGA
   
Sequence Name 26-K023494-022-070-G07C-LG01
GenBank Accession LN497743 [GenBank]
Sequencing primer gene specific primer, LG01: 5'-TTTCTACAGAATGGGACTTGATGA-3'
Sequence (A. th genome BLAST matches underlined)
>26-K023494-022-070-G07C-LG01
GGTTATTTTGATTTTGTTCTCTTTTGTGTTATTCATGTCAAACGTGAATATTTTTGTTAT
TCTGAATATTCTTTTTGACAAACAGGAAATAGTTGCCTTGTCTGGTGCACATACCTTAGG
GAGAGCCAGACCAGACCGTAGTGGTTGGGGAAAACCTGAGACAAAGTACACGGTATTAAT
AAACGACAAACTGAAGCTACCTTATATATAGTTCTAGGGATGATAGTGTAGAGAGATGTT
ATGGAAACGTTCAAAATGGCAGAAAACTGGACCTGGAGAAGCAGGAGGACAGTCATGGAC
AGTGAAATGGCTCAAGTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGA
CAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAA
ATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 23.10.2014 13:25