SimpleSearch - Line and FST details


Line specific information

 
Line ID 070G07
Vector Used pAC161
Line Availability only available from NASC (N406703)
Segregation Analysis 50:46:35
Confirmed for Hit At1g77490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77490

 
Sequence (A. th genome BLAST matches underlined)
>55-011733-strizhov-G7-35St
TGACGTAAGGGATGACGCACAATGCCCCTATCCTTCGCAAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTCATTTCATTTCAAGGTCTATCTCTCTATCTTTCTTAGTAACTTGG
TTTGGGACTGAAAAAGAGTTTTCTATGAAGTTTTCTAAAAATAGTTTTATCAACCATTGA
CTTCTATGACTTTGCAGGATATCAAAGAAAAGAGGGACGACGATCTTCTGGGGTTACCCA
CTGATGCGGCGCTATATCAAGATTCTGCATTCAAGGTTTAAACAACAGTGATTGCTAATA
AGATGCCTCAGAATTAGTAGTTCACTGATACTTAAGAGGAA
GenBank Accession AL768185 [GenBank]
Graphic View Graphic view of gene At1g77490
Predicted Position of Insertion Chr1:29119194 - go to primer design
BLAST e Value 1e-130
Hit Clone Code (BAC ID) T5M16
Hit Gene Code At1g77490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation thylakoidal ascorbate peroxidase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL768184 [GenBank]


Last Updated on 31.08.2016 09:40