Sequences from confirmation amplicon


Confirmation sequences for line 074D06 and hit At5g44080 are shown.
Line ID 074D06
Locus At5g44080 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:17739045
Primers used for PCR Z13a - 8474, show primer details
   
Sequence Name 21-K014702-022-074-D06C-8409
GenBank Accession LN495444 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K014702-022-074-D06C-8409
CTGTAGATTTCCCGGACATGAAGCCATTTACAATTGCTTTATCCAATGGCTCAACCATCA
CTCTCGCTCTCTTCCCTCTAGCTCCTCCTCCGTAAACATCTAAACCATTCCCAAACGCAA
CTATTGATCCTTCTACTTTATCAATCATCTGAAACGGATTATGCGGCGGTGCAGAATGAT
CGAATCCGTAATTCGTCACCGGAATCTTCACATCCAAATCCTCCGCCGACGCCGTCACCG
CTGTTTCGTCTTCCACCGCAGCTTTCGCTAGAAAATCCTCTAACGTCATTATCTCTTCCG
ACGTCTCTTCCTTCATCCCTTTACCTTCTCCTGATACCATCTCTCTCCAAATCTCATCAA
CACTCTTCCCACCACGCGTCGTCTCCGTTCCTCCGCCGTGATCCACAACATCAGAAGCCG
TCGTTGTTGTTATCTCCATTGGTGCTGGAGAAGCATCCATCAGATTTATCGACGCATCTA
AGAGTGAAGATTCCGTTGGTGCTGGTGGATCTGATGCGAAAGTATCGTGTAAAATCCCTT
CGAC
   
Sequence Name 22-K014702-022-074-D06C-Z13a
GenBank Accession LN495886 [GenBank]
Sequencing primer gene specific primer, Z13a: 5'-AAATTCGATGACGGTCGAAG-3'
Sequence (A. th genome BLAST matches underlined)
>22-K014702-022-074-D06C-Z13a
TTTTACACGATACTTTCGCATCAGATCCACCAGCACCAACGGAATCTTCACTCTTAGATG
CGTCGATAAATCTGATGGATGCTTCTCCAGCACCAATGGAGATAACAACAACGACGGCTT
CTGATGTTGTGGATCACGGCGGAGGAACGGAGACGACGCGTGGTGGGAAGAGTGTTGATG
AGATTTGGAGAGAGATGGTATCAGGAGAAGGTAAAGGGATGAAGGAAGAGACGTCGGAAG
AGATAATGACGTTAGAGGATTTTCTAGCGAAAGCTGCGGTGGAAGACGAAACAGCGGTGA
CGGCGTCGGCGGAGGATTTGGATGTGAAGATTCCGGTGACGAATTACGGATTCGATCATT
CTGCACCGCCGCATAATCCGTTTCAGATGATTGATAAAGTAGAAGGATCAATAGTTGCGT
TTGGGAATGGTTTAGATGTTTACGGAGGAGGAGCTAGAGGGAAGAGAGCGAGAGTGATGG
TTGAGCCATTGGATAAAGCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCA
GCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTT

Last Updated on 23.10.2014 13:25