Sequences from confirmation amplicon


Confirmation sequences for line 075A08 and hit At3g43270 are shown.
Line ID 075A08
Locus At3g43270 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:15222645
Primers used for PCR MR44 - 8474, show primer details
   
Sequence Name 01-K016196-022-075-A08C-8409
GenBank Accession LN486364 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K016196-022-075-A08C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTGCGGACATGATGCAATCAACC
CCGTAGGATGGCTTGAATGGAATGGAAATTTTGCGTTGGATACATTATATTATGGTGAGT
ATATGAATAGCGGACCGGGGGCTAGTCTTGACCGCCGTGTTAAGTGGCCAGGATACCATG
TGTTGAATACTTCGGCCGAGGCTAATAATTTTACAGTATCTCAACTCATACAAGGGAACT
TGTGGTTACCATCAACTGGTATCACGTTCATTGCTGGTCTAGTCTCGTAAATTAATCATG
TTTGATCGAATTCTAATATTATCATTTGATATATCATTTCTATTATACTAAACGTTATAA
TTATGTTTCTTGATGTTTTCTATTTTGTATATGGTTTTGGTTAAATTATTATTATTATTA
TTATTTTGGTGATATTGAACTACAAGTTCTCTACGTTTGATATGTATTTAATGAGTTATT
TTACTCGTAGAATTAAAGTCATATGTCAACCACATTTTTCTACCATTGATCTTCAAACAA
TGGATTTTATACATAATATTCTTTTCCAAAATCGTAT
   
Sequence Name 02-K016196-022-075-A08C-MR44
GenBank Accession LN486814 [GenBank]
Sequencing primer gene specific primer, MR44: 5'-AATATACCTCGCATACGATTTTGG-3'
Sequence (A. th genome BLAST matches underlined)
>02-K016196-022-075-A08C-mr44
AATATTATGTATAAAATCCATTGTTTGAAGATCAATGGTAGAAAAATGTGGTTGACATAT
GACTTTAATTCTACGAGTAAAATAACTCATTAAATACATATCAAACGTAGAGAACTTGTA
GTTCAATATCACCAAAATAATAATAATAATAATAATTTAACCAAAACCATATACAAAATA
GAAAACATCAAGAAACATAATTATAACGTTTAGTATAATAGAAATGATATATCAAATGAT
AATATTAGAATTCGATCAAACATGATTAATTTACGAGACTAGACCAGCAATGAACGTGAT
ACCAGTTGATGGTAACCACAAGTTCCCTTGTATGAGTTGAGATACTGTAAAATTATTAGC
CTCGGCCGAAGTATTCAACACATGGTATCCTGGCCACTTAACACGGCGGTCAAGACTAGC
CCCCGGTCCGCTATTCATATACTCACCATAATATAATGTATCCAACGCAAAATTTCCATT
CCATTCAAGCCATCCTACGGGGTTGATTGCATCATGTCCGCAATATTCAATTGTAAATGG
CTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAA
AGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTA
TAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAA
AGCAATAAACAAATTATTCTAATTCGGAAATCT

Last Updated on 23.10.2014 13:25