SimpleSearch - Line and FST details


Line specific information

 
Line ID 075A08
Vector Used pAC161
Line Availability only available from NASC (N407112)
Segregation Analysis 95:90:68
Confirmed for Hit At3g43270
Parent of DUPLO pair none
Parent of pair(s) 86363

Gene hit At3g43270

 
Sequence (A. th genome BLAST matches underlined)
>57-011890-strizhov-A8-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATTGCGGACATGA
TGAAGCCATCCTACGGGGTTGATCCATGTGCTATGGGATCCTCCCTATAGAGACGTTGTA
TTACTGAAGAGTATATGAATAGCGGACCGGGGGCTGTGGGATCCTCCTCTATAGAGAGTC
GATATACTCACAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGAT
GCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGAT
GGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTT
CACAATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCT
TTGTTGAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGA
GTAGACAAGCGTGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCG
TAAGAGACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAGGTCCTCTAT
TTGAATCTTTGACTCCATGGGAATTGGGGATCCTCTATGGGATCCTCCCTATAGNGAGTC
GAATTAC
GenBank Accession AL768480 [GenBank]
Graphic View Graphic view of gene At3g43270
Predicted Position of Insertion Chr3:15222645 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) F7K15
Hit Gene Code At3g43270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant invertase/pectin methylesterase inhibitor superfamily
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03