Sequences from confirmation amplicon


Confirmation sequences for line 075C07 and hit At2g45040 are shown.
Line ID 075C07
Locus At2g45040 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:18578078
Primers used for PCR SD07 - 8474, show primer details
   
Sequence Name 10-K023371w-022-075-C07C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K023371w-022-075-C07C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATACGTGTACCGGACGGCCCAGGTGG
ACAAGAGACGTCCCACTGAAACTCACGTACGCCTTCTCGCAGGAGAACCTAACTCCTTAC
TTAGCACCAACTGACATACGGCGCGTGTTCCGACGCGCTTTCGGCAAGTGGGCTTCGGTG
ATCCCAGTATCCTTCATCGAAACAGAGGATTACGTCATCGCCGACATCAAGATCGGATTC
TTCAACGGAGATCACGGCGACGGAGAACCGTTCGACGGCGTTTTAGGTGTTTTAGCACAC
ACTTTCTCTCCGGAAAACGGTAGGCTTCATCTAGACAAAGCAGAGACGTGGGCCGTAGAT
TTCGATGAGGAAAAATCTAGTGTGGCCGTCGATTTGGAATCTGTGGCGGTGCACGAGATC
GGTCACGTGCTTGGATTAGGACATAGCTCGGTGAAAGACGCGGCTATGTATCCAACTTTA
AAGCCAAGAAGTAAGAAAGTGAATTTGAATATGGACGACGTCGTTGGAGTACAGT
   
Sequence Name 14-K023371w-022-075-C07C-SD07
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer gene specific primer, SD07: 5'-TTCCGTACAAAGACTGTACTCCAA-3'
Sequence (A. th genome BLAST matches underlined)
>14-K023371w-022-075-C07C-SD07
CGACGTCGTCCATATTCAAATTCACTTTCTTACTTCTTGGCTTTAAAGTTGGATACATAG
CCGCGTCTTTCACCGAGCTATGTCCTAATCCAAGCACGTGACCGATCTCGTGCACCGCCA
CAGATTCCAAATCGACGGCCACACTAGATTTTTCCTCATCGAAATCTACGGCCCACGTCT
CTGCTTTGTCTAGATGAAGCCTACCGTTTTCCGGAGAGAAAGTGTGTGCTAAAACACCTA
AAACGCCGTCGAACGGTTCTCCGTCGCCGTGATCTCCGTTGAAGAATCCGATCTTGATGT
CGGCGATGACGTAATCCTCTGTTTCGATGAAGGATACTGGGATCACCGAAGCCCACTTGC
CGAAAGCGCGTCGGAACACGCGCCGTATGTCAGTTGGTGCTAAGTAAGGAGTTAGGTTCT
CCTGCGAGAAGGCGTACGTGAGTTTCAGTGGGACGTCTCTTGTCCACCTGGGCCGTCCGG
TACACGTATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATGTCCGCAGCGTNTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCT

Last Updated on 23.10.2014 13:25