SimpleSearch - Line and FST details


Line specific information

 
Line ID 075C07
Vector Used pAC161
Line Availability only available from NASC (N407135)
Segregation Analysis 100:91:79
Confirmed for Hit At2g45040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g45040

 
Sequence (A. th genome BLAST matches underlined)
>51-011890-strizhov-C7-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATGATCACAGACA
TAGAAAACAGTGCGTACGGCACCACACCTGACCTTGACATAACACACAAGCACCCATCCC
AAGTACCTAGATAACCATTGCAACGAAAAGAACATTCGGATCCTCGCTATAAGTCTCTCT
TATGCTCTACATGAACATGAGGTGCCTTTATTGCCGATCTCTACGGAAGACTACCTATAC
AGCGACATTTAAATCAGATTCTTCAACGGACATCACGGAGACGGAGAACCGTTCGACGGC
GTTTTACGTGTTTTAGCACACACTTCTCTCTCCGGAAAACGGTAGGCTTCATCTATGGGA
TCCTCCCTATAGTGAGTCG
GenBank Accession AL768497 [GenBank]
Graphic View Graphic view of gene At2g45040
Predicted Position of Insertion Chr2:18578072 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) T14P1
Hit Gene Code At2g45040 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Matrixin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23