Sequences from confirmation amplicon


Confirmation sequences for line 078H10 and hit At4g11820 are shown.
Line ID 078H10
Locus At4g11820 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:7109982
Primers used for PCR SI01 - 8474, show primer details
   
Sequence Name 17-K022912-022-078-H10C-8409
GenBank Accession LN493686 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K022912-022-078-H10C-8409
ATCTTTCCTCTCTTGCAGCTCCATTGACTAGGCTGCCAAAGAAAAGTTCACCCCTTATTC
ATCTTTGACCCTTGACGAGAGTTACCAAAGCCGTGATCTTGAAAAGGTTCTCATCATTTC
TCTTTTCTTTTGCTTTTGATACTGAGAGAAAACCGATTTATAGCTCAATCTGTTGTCTCT
TTTGCAGGTGTCACAACAAATTGCGAAACCGTTTTATGATGCTAAAGTGCAACCAACGAC
TTTAATACCAA
   
Sequence Name 21-K022912-022-078-H10C-SI01
GenBank Accession LN495490 [GenBank]
Sequencing primer gene specific primer, SI01: 5'-GCTACAGATCCATCTTCACCTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K022912-022-078-H10C-SI01
GAATCAACCTTCTTTCAGATAATAAGTTCCCGGTGCCAAAAGATCTATAATACCCTCCTT
GGTTGTCACAAAGTCCTTTGCTCCATACCTATGTTCCTTAGCTTCCTTGGCT

Last Updated on 07.07.2016 14:16