SimpleSearch - Line and FST details


Line specific information

 
Line ID 078H10
Vector Used pAC161
Line Availability only available from NASC (N407486)
Segregation Analysis 100:83:65
Confirmed for Hit At4g11820
Parent of DUPLO pair none
Parent of pair(s) 11813

Gene hit At1g15620

 
Sequence (A. th genome BLAST matches underlined)
>80-K016176-022-078-H10-8409
ATTTCCCGGACTGAAGCATTTACACAAACTCGACCAAATACAAACAGTGGTAAATGTAAA
TATATCACTCCATTGGACACCCTCATGCGGTCTTTTCTCATCAGCTGATGAAGGATTGCC
ATTGGTTGTAACGTCGACGATGTGCTCTTCATTTGAAGAAGAATCGCCATGGATTGTAAC
GTCATCGACGATGTGCTCACTCTGAGTCAACAAAGGGTCCTCCATTTATCACTTCTGCTT
TCTTCTATTTTCCCCAATCGAATTAAAAGTCCTTATTAATCCGCTTTAAAACACAGAGCA
CATAAAGCCATCTCCAGTTCTTTGGTGCTTAATTATTATTTTAAGACCAATCTACGTCGA
GATCTATTCTATAAGTCAATTGTAATATTTCGAAGTCGTCGTTCGGTTCTAAATTATTAC
TCCAGATCGACATCATTCGTAATCCTATGGGATC
GenBank Accession AL937388 [GenBank]
Graphic View Graphic view of gene At1g15620
Predicted Position of Insertion Chr1:5373755 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T16N11
Hit Gene Code At1g15620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g11820

 
Sequence (A. th genome BLAST matches underlined)
>80-K016174-022-078-H10-8409
ACATTTGGNTTGAAGTTTGTTACACATGTGTATGGTTGATTTAGGCGGGAAAGCGGGTGG
TTATGTTCTCTTATGGAAGTGGCTCAACCGCAACAATGTTCTCATTACGCCTCAACGACA
ATAAGCCTCCTTTCAGCATTTCAAACATTGCATCTGTAATGGATGTTGGCGGTAAATTGA
AAGC
GenBank Accession AL937387 [GenBank]
Graphic View Graphic view of gene At4g11820
Predicted Position of Insertion Chr4:7110023 - go to primer design
BLAST e Value 7e-98
Hit Clone Code (BAC ID) T26M18
Hit Gene Code At4g11820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hydroxymethylglutaryl-CoA synthase / HMG-CoA synthase / 3-hydroxy-3-methylglutaryl coenzyme A synthase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03