Sequences from confirmation amplicon


Confirmation sequences for line 088B04 and hit At4g27570 are shown.
Line ID 088B04
Locus At4g27570 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:13765172
Primers used for PCR PE55 - 8474, show primer details
   
Sequence Name 25-K023014-022-088-B04C-8409
GenBank Accession LN497262 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K023014-022-088-B04C-8409
GATTTCCCGGACATGAAGCCATTTACAATTGAATATATATTAATAACTATCGAGAGAACA
CAACCAGAGTTAGGTAGGCCTTGTTAGATTTTCACACCAAACCCTGGCACTATATATAGA
CCCATCTAGTATCCAAAGCATAATAGAGATACAAAGAAACAAGAAAACGAAAAGAAAATA
TACAGAAATGGGTGGTTTGAAGTTTCATGTACTTATGTATCCATGGTTCGCAACAGGCCA
TATGACCCCGTTCCTTTTTCTTGCCAACAAATTGGCTGAGAAAGGTCATACGGTCACTTT
CTTGCTTCCCAAGAAATCTCTGAAACAGTTGGAACATTTCAATCTGTTTCCACACAACAT
TGTCTTTCGCTCTGTCACCGTCCCTCATGTGGATGGTCTCCCCGTTGGCACAGAGACAGC
CTCTGAGATCCCTGTGACATCAACTGATCTCTTGATGTCTGCTATGGATCTCACACGTGA
TCAAGTTGAAGCTGTGGTCCGAGCCGTTGAACCGGACCTGATCTTCTTTGACTTTGCTCA
TTGGATTCCAGAAGTAGCTAGGGACTTCGGCCTTAAGACTGTAAAGTACGTCGTGGTGTC
TGCATCGACTATAGCTAGTATGCTTGTCCCAGGTGGTGAGTTAGGTGTTCCTCCACCGGG
ATATCCATCATCAAAGGTGCTGCTTCGTAAACAAGATGCTTACACTATGAAGAAACTGGA
GCCTA
   
Sequence Name 26-K023014-022-088-B04C-PE55
GenBank Accession LN497739 [GenBank]
Sequencing primer gene specific primer, PE55: 5'-ACATCGATTGTATTTGTAGGCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K023014-022-088-B04C-Pe55
TTTCTTCATAGTGTAAGCATCTTGTTTACGAAGCAGCACCTTTGATGATGGATATCCCGG
TGGAGGAACACCTAACTCACCACCTGGGACAAGCATACTAGCTATAGTCGATGCAGACAC
CACGACGTACTTTACAGTCTTAAGGCCGAAGTCCCTAGCTACTTCTGGAATCCAATGAGC
AAAGTCAAAGAAGATCAGGTCCGGTTCAACGGCTCGGACCACAGCTTCAACTTGATCACG
TGTGAGATCCATAGCAGACATCAAGAGATCAGTTGATGTCACAGGGATCTCAGAGGCTGT
CTCTGTGCCAACGGGGAGACCATCCACATGAGGGACGGTGACAGAGCGAAAGACAATGTT
GTGTGGAAACAGATTGAAATGTTCCAACTGTTTCAGAGATTTCTTGGGAAGCAAGAAAGT
GACCGTATGACCTTTCTCAGCCAATTTGTTGGCAAGAAAAAGGAACGGGGTCATATGGCC
TGTTGCGAACCATGGATACATAAGTACATGAAACTTCAAACCACCCATTTCTGTATATTT
TCTTTTCGTTTTCTTGTTTCTTTGTATCTCTATTATGCTTTGGATACTAGATGGGTCTAT
ATATAGTGCCAGGGTTTGGTGTGAAAATCTAACAAGGCCTACCTAACTCTGGTTGTGTTC
TCTCGATAGTTATTAATATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT
TTT

Last Updated on 07.07.2016 14:16