SimpleSearch - Line and FST details


Line specific information

 
Line ID 088B04
Vector Used pAC161
Line Availability only available from NASC (N408368)
Segregation Analysis 50:49:38
Confirmed for Hit At4g27570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g27570

 
Sequence (A. th genome BLAST matches underlined)
>26-K016184-022-088-B04-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATATTAATAACTATCGAG
AGAACACAACCAGAGTTAGGTAGGCCTTGTTAGATTTTCACACCAAACCCTGGGACTATA
TATAGACCCATCTATGGGATCCTCCCTATAATGAGACTTACAACACTTTCATGGTCAGAT
AATTATCCAACACTGAGAGGACAACGAATAGAAAGCAAAGAATACTCTATGTCCCACAAA
ACCCTCTATAGACTCACGCTTCACTACAGAGCTATGGGATCCTCCATATAGTGAGACGGT
CACTTTCTTGCTTCCCAAGAAATCTCTGAAACAGTTGGAACATTTCAATCTGTTTCCACA
CAACATTGTCTTTCGCTCTGTCACCGTCCCTCATGTGGATGGTCTCCCCGTTGGCACAGA
GACAGCCTCTGAGATCCCTGTGACATCAACTGATCTCTTGATGTCTGCTATGGATCTCAC
ACGTGATCAAGTTGAAGCTGTGGTCCGAGCCGTTGAACCGGACCTGATCTTCTTTGACTT
TGCTCATTGGATTCCAGAAGTAGCTATGGGAT
GenBank Accession AL937628 [GenBank]
Graphic View Graphic view of gene At4g27570
Predicted Position of Insertion Chr4:13765153 - go to primer design
BLAST e Value 1e-151
Hit Clone Code (BAC ID) T29A15
Hit Gene Code At4g27570 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23