Sequences from confirmation amplicon


Confirmation sequences for line 089E10 and hit At4g10490 are shown.
Line ID 089E10
Locus At4g10490 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:6483743
Primers used for PCR MZ26 - 8474, show primer details
   
Sequence Name 56-K024138-022-089-E10C-MZ26
GenBank Accession LN508984 [GenBank]
Sequencing primer gene specific primer, MZ26: 5'-AGTCGAAGGAAGTCTCTCCAGTTA-3'
Sequence (A. th genome BLAST matches underlined)
>56-K024138-022-089-E10C-MZ26
GACTTTCTCTTTGGAAACGTTGAAACTTGTGGAGAGTCTCGTTGTCTTTTTGGTATCTGC
TGAGTAATGCTTCACTCTTTCGCTCTCTGATTGCCGGAAAAACTCTCTTGCCGCATTCAT
CATTTTTTTGATCGTTTCTTCTGGTACTCCATGGTTCTTGATCTGGAACAGAGGAAACAA
ATCTAGTGTAAAATCATGAAAGAAAGAAAAACAGTATTGCAAAACCCTAGTGTAAAATCA
AGAAAAGATAAGAGTGTTACTCAAGAAACCAGAGTATAGGAGATTAAAAGTGGATTGTTT
GTGCACTTACCTGGAAGAAGCCACAAGAAGAGCATGCATGAGCAAACTGATTGATAATGT
CAGCTCGATTAGGTCCATGGAGGTCGTGGAGATCGATTAGAGGAATAGAGTCGCCGGAAG
TTTGAACCTCGGACATTTTTGGACGGTCAGAGACTGGTCTGACGTAGTTTGAAGGGACGT
GATCAACGACAGAGGCGATGTCGGATACGAGGAGTTTTGATGCTGCCATGATTGGTTTAA
AATCTGAAGTGAGAGCGATAATGAGAGAAAGAGAGAGATATGTTATGGTACAATATCACA
TGAGTCATAGTCTCAAAGATGTGTTATATAAGGACAAGGACACCGCACGAGTTTTATACT
TTGTCCTTTTTAAGTAAGAAATCTGGACATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGA
   
Sequence Name 57-K024138-022-089-E10C-8409
GenBank Accession LN509293 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>57-K024138-022-089-E10C-8409
ATTCCCGGACATGAAGCCATGTCCAGATTTCTTACTTAAAAAGGACAAAGTATAAAACTC
GTGCGGTGTCCTTGTCCTTATATAACACATCTTTGAGACTATGACTCATGTGATATTGTA
CCATAACATATCTCTCTCTTTCTCTCATTATCGCTCTCACTTCAGATTTTAAACCAATCA
TGGCAGCATCAAAACTCCTCGTATCCGACATCGCCTCTGTCGTTGATCACGTCCCTTCAA
ACTACGTCAGACCAGTCTCTGACCGTCCAAAAATGTCCGAGGTTCAAACTTCCGGCGACT
CTATTCCTCTAATCGATCTCCACGACCTCCATGGACCTAATCGAGCTGACATTATCAATC
AGTTTGCTCATGCATGCTCTTCTTGTGGCTTCTTCCAGGTAAGTGCACAAACAATCCACT
TTTAATCTCCTATACTCTGGTTTCTTGAGTAACACTCTTATCTTTTCTTGATTTTACACT
AGGGTTTTGCAATACTGTTTTTCTTTCTTTCATGATTTTACACTAGATTTGTTTCCTCTG
TTCCAGATCAAGAACCATGGAGTACCAGAAGAAACGATCAAAAAAATGATGAATGCGGCA
AGAGAGTTTTTCCGGCAATCAGAGAGCGAAAGAGTGAAGCATTACTCAGCAGATACCAAA
AAGACAACGAGACTCTCCACAAGTTTCAACGTTTCCAAAGAGAAAGTCTCTAACTGGA

Last Updated on 23.10.2014 13:25