SimpleSearch - Line and FST details


Line specific information

 
Line ID 089E10
Vector Used pAC161
Line Availability only available from NASC (N408506)
Segregation Analysis 50:50:45
Confirmed for Hit At4g10490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F1I21

 
Sequence (A. th genome BLAST matches underlined)
>77-K016186-022-089-E10-8409
GTCGACTCTATGGGATCCTCCCTATAGTAGAGAATATGTTATCTCGTTAAACAAATAGTT
ATATACTTATTTACAAATATTAAAGTTATTTTGAATCAATGGCATTTTTGTAATTAATCT
AAAAAGGAAGGATAATTTTGGTTTATATTTTATTTCTCTTTCCTATTTACCTAAATAACA
AATTTTTATGTATAAATTCTTAATTTCTTGTTTATCCATGTATATATTTTTAACTCACCC
TATTTTTTAGTTATTTATTTTTGTAAACGCTTTTTTTCTTTTAACATAATAGGACTCTGT
TTTTGCTTTTGCCATTTTGTCTCGGGGTCTCTCGAAAGCTCAAGCCGGCGACAAGCTCCC
ATTGCATCGTAGACGAGAACGGTCAACGTAAAGCTATGGG
GenBank Accession AL937846 [GenBank]
Graphic View Graphic view of sequence AL937846 of line 089E10
Predicted Position of Insertion Chr1:16237041 - go to primer design
BLAST e Value 1e-90
Hit Clone Code (BAC ID) F1I21
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g10490

 
Sequence (A. th genome BLAST matches underlined)
>77-K016187-022-089-E10-8409
CGACCCTATGGGATCATCCCTATAGTGAGAGGACAAGATAAAACTCGTGCGGTGTCCTTG
TCCTTATATAACACATCTTTGAGACTATGACTCATGTGATATTGTACCATAACATATCTC
TCTCTTTCTCTCATTATCGCTCTCACTTCAGATTTTAAACCAATCATGGCAGCATCAAAA
CTCCTCGTATCCGACATCGCCTCTGTCGTTGATCACGTCCCTTCAAACTACGTCAGACCA
GTCTCTGACCGTCCAAAAATGTCCGAGGTTCAAACTTCCGGCGACTCTATTCCTCTAATC
GATCTCCACGACCTCCATGGACCTAATCGAGCTGACATTATCAATCAGTTTGCTCATGCA
TGCTCTTCTTGTGGCTTCTTCCAGGTAAGTGCACAAACAATCCACTTTTAATCTCCTATA
CTCTGGTTTCTTGAGTAACACTCTTATCTTTTCTTGATTTTACACTATGGGAT
GenBank Accession AL937847 [GenBank]
Graphic View Graphic view of gene At4g10490
Predicted Position of Insertion Chr4:6483772 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F7L13
Hit Gene Code At4g10490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03