Sequences from confirmation amplicon


Confirmation sequences for line 090B05 and hit At2g30470 are shown.
Line ID 090B05
Locus At2g30470 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:12985153
Primers used for PCR ZZ18 - 8474, show primer details
   
Sequence Name 25-K020243-022-090-B05C-8409
GenBank Accession LN497245 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K020243-022-090-B05C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCTTCAAGTGTCGTGCATGCA
TTTTATGCGTTTCGTTCACTTGCATGCTCTCTCCCTCTTTCTCTCTCTATCTCACCCATA
AAAGTTTTAATTTTTCACATCGATAAATTAAATTGAAACAAAAAAAAAAATTCACCCAAA
AAAAAAAAACCTCGTGGCCTTTTTTTTCGCCGTAACAGCCCTTTTTTTTTTTTCAATTCG
CCGGAAAAATTTTTTTTTTTTTTTCCCCCGCGGGCCCTTCACCAATCCTTTGATTTCTTT
ACACACAAACCTTTGATTTTGACCAACGCCAATGCAGGTTCATGACTAGTCTCTTCCTCA
ATCCTTC
   
Sequence Name 29-K020243-022-090-B05C-ZZ18
GenBank Accession LN499099 [GenBank]
Sequencing primer gene specific primer, ZZ18: 5'-ATTGATGAAATTGAAGGATTGAGG-3'
Sequence (A. th genome BLAST matches underlined)
>29-K020243-022-090-B05C-ZZ18
TAGTCATGAACATGCATCGACGTTGGTCAAAATCAAAGGTTCGTGTGTAGAGAGATCAGA
GGATTGGTGAAGGACCGGCGGGGGAAGAGAAAGAGAAGATTTTGACGGCGAATTGAAGAA
AGAAAGAGGACTGTAACGGCGAAGAAGAAGGCAACGAGGTTTTTTTTTTTTGGGGGAATT
TTTTTTTTTGTTCCAATTTAATTTACCGAGGGGAAAAATTAAAACTTTTTTGGGGGAAAT
AAAAAAAAAAAGGGGGAGAAACCTTGCAAGGGAACAAACCCCTTAAAAGGCTTGCCCAAC
CCTTGAAAATTTTTTCAATTGAAAAGGGTTTCTTGCCCGGGAAATCTCCTGGGATCCCCA
ATGAGTTTGAGGGCCAATTTGGAAAAAAAAAAAGAGTATTTCCCATTTTTTTTTCATTTC
AAAAAGGAAAATGCCCCCAGCGTTTTTATAAAAGGAAAGTCCTTTTTGATAAAACAACAA
TTTCCGACCCGCCTTTTTTTTGGGGGAAAGCAATAACCAATTTT

Last Updated on 07.07.2016 14:16